Содержание

L-валин

Валин – незаменимая аминокислота, оказывающая стимулирующее действие. Валин необходим для метаболизма в мышцах, восстановления поврежденных тканей и для поддержания нормального обмена азота в организме. Относится к разветвленным аминокислотам, и это означает, что он может быть использован мышцами в качестве источника энергии. Валин часто используют для коррекции выраженных дефицитов аминокислот, возникших в результате привыкания к лекарствам.

Чрезмерно высокий уровень валина может привести к таким симптомам, как парестезии (ощущение мурашек на коже), вплоть до галлюцинаций.

Валин содержится в следующих пищевых продуктах: зерновые, мясо, грибы, молочные продукты, арахис, соевый белок.

Прием валина в виде пищевых добавок следует сбалансировать с приемом других разветвленных аминокислот – L-лейцина и L-изолейцина.

Симптомы недостаточности валина неизвестны.

При избыточном приеме валин просто преобразуется в другие аминокислоты, поэтому он в общем считается безопасным.

Людям, страдающим заболеваниями почек и печени, необходимо проконсультироваться со своим врачом перед началом приема валина. Может снижать эффективность действия лекарств от болезни Паркинсона.

Литература:
Майкл Рисман Биологически активные пищевые добавки. Неизвестное об известном;
Клатц Голдман Победить время.

Входит в состав следующих препаратов:

%d0%b8%d0%b7%d0%be%d0%bb%d0%b5%d0%b9%d1%86%d0%b8%d0%bd — English translation – Linguee

bb) содействовать созданию [. ..]

у женщин и девочек положительного представления о профессиональной деятельности в области науки

[…]

и техники, в том числе в средствах массовой информации и социальных средствах информации и через информирование родителей, учащихся, преподавателей, консультантов по вопросам профориентации и разработчиков учебных программ, а также посредством разработки и расширения других стратегий, призванных стимулировать и поддерживать их участие в этих областях

daccess-ods.un.org

(bb) Promote a positive image […]

of careers in science and technology for women and girls, including in the mass media and

[…]

social media and through sensitizing parents, students, teachers, career counsellors and curriculum developers, and devising and scaling up other strategies to encourage and support their participation in these fields

daccess-ods.un.org

Эта опция меню будет доступна после установки CD/DVD/BDROM-привода в NMT, или при подключении внешнего USB-привода CD/DVD/BDROM.

popcornhour.es

This option will only be accessible when a CD/DVD/BD-ROM drive has been installed into
or attached to your NMT.

popcornhour.es

Политика управления денежными средствами Компании ограничивает суммы финансовых активов, которые можно содержать в каком-либо из банков, в зависимости от размера капитала уровня такого банка и его долгосрочного кредитного рейтинга, присвоенного агентством Standard & Poors (например, не более 40% для банка с рейтингом «BB» на 31 декабря 2010 года).

kmgep.kz

The Company’s treasury policy limits the amount of financial assets held at any one bank to the lower of a stipulated maximum threshold or a percentage of the bank’s Tier I capital, which is linked to the banks long term counterparty credit rating, as measured by Standard and Poor’s rating agency, (e.
g. not greater than 40% for a BB rated bank at December 31, 2010).

kmgep.kz

BD выпускается в строгом соответствии с техническими условиями, все аудио могут быть расшифрованы вывода см. в разделе BD RIP, BD ISO треков были совершенны следующего поколения выходе источника

macbook-covers.net

BD produced in strict accordance with specifications, all the audio can be decoded output, see
B
D RIP, BD ISO tracks were perfect the next generation of source output

macbook-covers.net

В состав Совета войдут также заместитель Генерального директора по вопросам социальных и гуманитарных наук (ADG/SHS),

[…] […] директор Бюро стратегического планирования (DIR/BSP), директор Бюро бюджета (DIR/BB), директор Бюро информации общественности (DIR/BPI) и – в зависимости от темы [.
..] […]

и потребностей всемирного доклада – еще один заместитель Генерального директора по одному из программных секторов.

unesdoc.unesco.org

Other members will be ADG/SHS, DIR/BSP, DIR/BB, DIR/BPI and – subject to the specific theme and exigencies of a world report – another Programme Sector ADG.

unesdoc.unesco.org

Еще больше положение компании в

[…] […] глазах  рынка было ухудшено решением рейтингового агентства S&P поместить кредитный рейтинг ENRC  BB+ на “credit watch negative”, что подразумевает повышенную вероятность падения рейтинга компании в ближайшие […]

три месяца.

halykfinance.kz

To make things even worse, S&P placed ENRC’s BB+ credit rating on “credit watch negative”, which implies a higher probability of a downgrade into junk territory over the next three months.

halykfinance. kz

C. Согласившись с

[…] тем, что BSP и BB следует отнести […]

к одному структурному элементу и так же, как BFC, они непосредственно

[…]

связаны с программой, эти члены Группы сочли, что по своему характеру эти службы обеспечивают выполнение программы и поэтому должны фигурировать в Части III бюджета вместе с Бюро по управлению людскими ресурсами (HRM).

unesdoc.unesco.org

C. While agreeing that BSP

[…] and BB should be placed together […]

and, with BFC, were directly linked to programme, they considered

[…]

that this was in a programme support capacity and that these services should therefore figure under Part III of the budget along with HRM.

unesdoc.unesco.org

Долгосрочный рейтинг в иностранной и национальной валюте подтвержден на уровн
е
«BB».

telecom.kz

The long-term rating in foreign and national currency was confirmed at “BB” level.

telecom.kz

1BB 2 b iii 2 Добыча Летучие выбросы (исключая удаление газа и сжигание в факелах) из газовых скважин через входные отверстия на устройствах переработки газа или, если обработка не требуется, в точках стыковки систем транспортировки […]

газа.

ipcc-nggip.iges.or.jp

1B 2 b iii 2 Production Fugitive emissions (excluding venting and flaring) from the gas wellhead through to the inlet of gas processing plants, or, where processing is not required, to the tie-in points on gas transmission systems.

ipcc-nggip.iges.or.jp

Модели BJ и BB стали первыми марками холдинга […]

Mack, построенными под влиянием новых транспортных веяний — машины способные

[…]

перевозить более тяжелые и объемные грузы с большей скоростью.

trucksplanet.com

The Models BJ and BB were the first trucks of Mack […]

Company, built under the influence of new transport trends — machines

[…]

capable of carrying heavy and bulky loads with greater speed.

trucksplanet.com

В мае 2012 года рейтинговое агентство Fitch Rating повысило долгосрочные рейтинги Новосибирской

[…]

области в иностранной и национальной

[…] валюте с уровня «BB» до «BB+», а также долгосрочный […]

рейтинг по национальной шкале –

[…]

с уровня «AA-(rus)» до «AA(rus)».

pwc.ru

In May 2012, Fitch Ratings changed its long-term rating for the Novosibirsk

[…]

Region (in foreign and local currency)

[…] from BB to BB+, and its long-term national-scale [. ..]

rating from AA-(rus) to AA(rus).

pwc.ru

Вторая категория (BBB, BB, B) — стартап имеет готовый […]

или почти готовый (тестирующийся) продукт и начал привлекать первых

[…]

клиентов, однако пока не демонстрирует высоких темпов роста клиентской базы и доходов.

digitaloctober.ru

Second category (BBB, BB, B) — the startup has […]

a finished or almost finished (at the testing stage) product and has started

[…]

attracting its first clients, but has not get demonstrated a high income or client base growth rate.

digitaloctober.com:80

16.11.2009 МРСК Центра присвоен

[…] кредитный рейтинг S&P «BB/B/ruAA-» прогноз «Стабильный», […]

свидетельствующий о способности

[. ..]

и готовности Компании своевременно и в полном объеме выполнять свои финансовые обязательства.

euroland.com

16.11.2009 IDGC of

[…] Centre was assigned a BB-/B/ruAA— credit rating […]

(“Stable”) by S&P, thus testifying to the Company’s capability

[…]

and readiness in the performance of its financial obligations.

euroland.com

Международное рейтинговое агентство Fitch повысило приоритетный необеспеченный рейтинг эмиссии еврооблигаций TNK-BP International Ltd /ТНК-ВР/ на сумму 700 млн долл. с уровня «BB+» до «BBB-, а также приоритетный необеспеченный рейтинг гарантированной программы по выпуску долговых обязательств объемом 5 млрд долл. и существующего выпуска облигаций в рамках программы в размере 1,5 млрд долл. с уровня «BB+» до «BBB-.

tnk-bp.com

The international rating agency Fitch raised the priority unsecured rating of the issue of eurobonds of TNK-BP International Ltd. (TNK-BP) by $700 million from the level BB+ to BBB- and the priority unsecured rating of the issue of debt securities for $5 billion and the current issue of bonds for program implementation for $1.5 billion from the level BB+ to BBB-.

tnk-bp.com

Используйте сигнал BB или синхронизирующий сигнал уровня HDTV 3 в качестве […]

внешнего синхронизирующего сигнала.

service.jvcpro.eu

Make use of BB signal or HDTV 3 level synchronizing signal as the external […]

synchronizing signal.

service.jvcpro.eu

bb) должны быть упакованы […]

в закрытые контейнеры, которые были официально опечатаны и имеют регистрационный номер зарегистрированного

[. ..]

питомника; этот номер должен быть также указан в фитосанитарном сертификате в разделе «Дополнительная декларация.

fsvfn.ru

bb) be packed in closed containers […]

which have been officially sealed and bear the registration number of the registered

[…]

nursery; this number shall also be indicated under the rubric “Additional Declaration” on the Phytosanitary Certificate.

fsvfn.ru

bb) Место производства, свободное […]

от вредного организма – место производства, где данный вредный организм отсутствует, и

[…]

где оно официально поддерживается, cc) Участок производства, свободный от вредного организма — Определённая часть места производства, для которой отсутствие данного вредного организма научно доказано, и где в случае необходимости оно официально поддерживается в течение определённого периода времени, и которая управляется как отдельная единица, но таким же образом, как и свободное место производства.

fsvfn.ru

bb) Pest free place of production […]

denotes to a place of production where a specific type of pest is not present and the

[…]

place is officially protected, 3 cc) Pest free production site denotes to a production area where a specific type of pest is not present and this status is officially protected for a certain period of time and to a certain part of production area administered as a separate unit as in the case of place of production free from pests.

fsvfn.ru

После того как вы загрузите изображение, вы

[…]

сможете поместить его в своих сообщениях,

[…] используя специальный BB код, который отображается […]

под изображением при просмотре на полный экран.

forum.miramagia.ru

When you have uploaded a picture, you can place it in your

[…] posts by using the BB code text that is displayed [. ..]

below the image when you view it at full size.

forum.miramagia.com

В нее входят 6 базовых

[…] шасси с дополнительным индексом BB и колесными формулами 4×4, 6х6 и 8×8 (модели от 16.33ОBB до 41.460BB) с полезной нагрузкой 8-27 т и […]

рядными 6-цилиндровыми

[…]

двигателями мощностью 326-460 л.с. Эту гамму замыкают седельные тягачи BBS (6×6/8×8) с допустимой нагрузкой на седло от 12 до 30 т, приспособленные для работы в составе автопоездов полной массой до 120 т и развивающие максимальную скорость 90 км/ч. Их оснащают 660-сильным дизелем V10, а наиболее тяжелые машины комплектуют автоматизированной 12-ступенчатой коробкой передач ZF.

trucksplanet.com

It has a bolster payload from 12 to 30

[…]

tons and GCVW is up

[…] to 120 tons. Maximum speed is 90 km/h. The semi-tractors are equipped with a 660 hp diesel engine V10, and the most heavy trucks are [. ..]

used an automatic 12-speed transmission ZF.

trucksplanet.com

S&P также понизило оценку риска перевода и

[…]

конвертации валюты для украинских

[…] несуверенных заемщиков с «BB» до «BB», однако подтвердило краткосрочные […]

рейтинги Украины по

[…]

обязательствам в иностранной и национальной валюте на уровне «В», рейтинг по национальной шкале «uaAA» и рейтинг покрытия внешнего долга на уровне «4».

ufc-capital.com.ua

S&P also downgraded the risk of currency transfer and

[…]

conversion for Ukrainian non-sovereign

[…] borrowers from BB to BB-, but confirmed the short-term ratings […]

of Ukraine for liabilities

[…]

denominated in foreign and domestic currencies – at B level, its national scale rating — uaAA and foreign debt coverage rating – at the level 4.

ufc-capital.com.ua

Для целей повышения безопасности и защиты корпоративной информации, СКУД bb guard является не просто профессиональным устройством контроля доступа с распознаванием лица, а предоставляет возможность интеграции как с системой bb time-management (с последующим формированием различных отчетов о посещаемости сотрудников […]

для целей финансовой мотивации),

[…]

так и c третьими устройствами, такими как: электрические замки, сигнализация, датчики и т.д.

moscow-export.com

In order to increase security of corporate information, bb guard is not only a professional device for access control with face recognition, it also presents the possibility of integration with system bb time-management (with subsequent formation of various reports of staff attendance for their motivation) [. ..]

and with outside devices such as  electric locks, alarms, sensors, etc.

moscow-export.com

ADM/DCO будет также тесно

[…] сотрудничать с BSP, BB, HRM и ADM/ DIT в целях […]

обеспечения эффективной интеграции между системой

[…]

SISTER, планируемой системой управления информацией о людских ресурсах и системой FABS.

unesdoc.unesco.org

ADM/DCO will also be working

[…] closely with BSP, BB, HRM and ADM/ DIT to make […]

sure that there is seamless integration between

[…]

SISTER, the planned Human Resources Information Management System and FABS.

unesdoc.unesco.org

Оба этих варианта добавляют связь к оригинальному сообщению,

[…]

показывая имя автора, дату и время

[…] сообщения, в то время как BB Код тэг Цитировать указывает [. ..]

нужное сообщение без этой дополнительной информации.

ipribor.com.ua

Both these options add a link to the original post showing the name of the poster and the date and

[…]

time of the post, whereas the

[…] Bulletin Board Code quote tag simply quotes the relevant post […]

without this additional information.

ipribor.com

Самостоятельная

[…]

финансовая позиция Самрук-Энерго на

[…] уровне рейтинговой категории BB отражает преимущество вертикальной […]

интеграции, так как деятельность

[…]

компании включает весь процесс выработки энергии, начиная от добычи угля и заканчивая генерацией и распределением электрической и тепловой энергии.

halykfinance.kz

SE’s standalone business and financial profile

[…] is assessed at BB rating category, which benefits [. ..]

from its vertical integration as its

[…]

activities range from coal mining to generation and distribution of power and heat.

halykfinance.kz

Насос типа MSD имеет самый широкий спектр гидравлических характеристик из всех

[…] многоступенчатых насосов класса BB3 на рынке.

sulzer.com

The MSD pump has the broadest

[…] hydraulic coverage of any BB3 type multistage pump […]

in the market.

sulzer.com

bb) проводить регулярный […]

обзор процесса дальнейшего осуществления Пекинской платформы действий и в 2015 году в установленном

[…]

порядке собрать все заинтересованные стороны, включая гражданское общество, для оценки прогресса и проблем, уточнения задач и рассмотрения новых инициатив через 20 лет после принятия Пекинской платформы действий

daccess-ods. un.org

(bb) To review regularly […]

the further implementation of the Beijing Platform for Action and, in 2015, to bring together all

[…]

relevant stakeholders, including civil society, to assess progress and challenges, specify targets and consider new initiatives as appropriate twenty years after the adoption of the Beijing Platform for Action

daccess-ods.un.org

Также нельзя не упомянуть, что серьезным прорывом Банка стало получение самого высокого рейтинга среди всех частных банков страны со 100%-ным местным капиталом (одновременно это и второй лучший рейтинг среди всех частных банков Азербайджана) от

[…]

международного рейтингового агентства Standard &

[…] Poor’s — долгосрочный BB и краткосрочный […]

‘B’, прогноз изменения рейтинга — «стабильный».

pashabank.az

It should be also noted that receiving highest rating among all private banks of the country with 100 % local capital (simultaneously ranking second in rating among all private banks of Azerbaijan) from the

[. ..]

International Rating Agency Standard &

[…] Poor’s: long-term and short-term BBB with […]

«stable» outlook has become a significant breakthrough of the Bank.

pashabank.az

В свою очередь, основание извещателя

[…] […] должно быть установлено в корпусе для установки в подвесной потолок FAA‑500BB или в коробке для установки на поверхность потолка FAA‑500‑SB.

resource.boschsecurity.com

In addition, the detector base must be installed in an FAA‑500‑BB Ceiling Mount Back Box or in an FAA‑500‑SB Surface Mount Back Box.

resource.boschsecurity.com

bb) меморандум о взаимопонимании […]

между национальным управлением Румынии по противодействию отмыванию денежных средств и

[…]

секретариатом по противодействию отмыванию денег и имущества Парагвая о сотрудничестве в области обмена данными финансовой разведки об отмывании денег и финансировании терроризма, подписанный в Бухаресте, декабрь 2008 года, и Асунсьоне, декабрь 2008 года

daccess-ods. un.org

(bb) Memorandum of understanding […]

between the Romanian National Office for Preventing and Combating Money-laundering and

[…]

the Paraguayan Secretariat for Prevention of Money-laundering or Property on cooperation in financial intelligence exchange related to money-laundering and terrorist financing, signed in Bucharest, December 2008, and in Asunción, December 2008

daccess-ods.un.org

AccessBank признан самым надежным банком в

[…]

Азербайджане международным

[…] рейтинговым агентством Fitch («BB+ прогноз — стабильный»), […]

а также на ежегодных наградах компании

[…]

Global Finance (2011) и Издательской Группы Euromoney (в 2012, 2011 и 2010 году) назван «Лучшим Банком Азербайджана» и получил награду The Banker «Банк года» (2011).

anskommers.ws

AccessBank is recognized as the Most Reliable

[. ..]

bank in Azerbaijan by Fitch

[…] International Ratings (‘BB+ Outlook Stable‘), and as «The […]

Best Bank in Azerbaijan» by Global

[…]

Finance (2011) and Euromoney (2012, 2011 and 2010) in their annual awards as well as «The Bank of the Year» by The Banker (2011).

anskommers.ws

BCAA 2:1:1

ВСАА входит в тройку самых популярных продуктов спортивного питания. Представляет собой комплекс из трех незаменимых аминокислот в свободной форме: Л-лейцина, Л-Валина и Л-Изолейцина. Популярность продукта обусловлена его доказанными свойствами снижать темпы распада мышечного протеина, неизбежно возникающего при длительных физических нагрузках, а также прямым образом стимулировать синтез белка в мышечной ткани посредством влияния на специальные сигнальные системы. В результате дополнительного приема аминокислот ВСАА, спортсмены отмечают сокращение времени восстановления между тренировками и более интенсивный рост мышечной массы. При этом они могут применяться как непосредственно до, во время и после тренировки, так и в любое другое время дня вместе с белковой пищей. Спортивные диетологи рекомендуют принимать аминокислоты ВСАА представителям силовых и циклических видов спорта, а в последнее время они вошли и в рацион «игровиков», в частности активно применяют ВСАА хоккеисты, футболисты и регбисты.

(Степень мышечных повреждений в результате тренировок и болевых ощущений меньше в результате приема ВСАА)

Другой областью применения ВСАА, которую нельзя не отметить, является обогащение вегетарианских либо любых других диет с ограниченным числом протеина животного происхождения, так как именно дефицит лейцина, валина и изолейцина присущ всем без исключения  растительным белкам, что делает их менее полноценными. Соотношение аминокислот в продукте классическое 2:1:1 (L-Лейцин, L-Валин и L-Изолейцин).

Характеристики:

Объем

150 каплет

Вкус

Без вкуса

Аминокислоты

L-Лейцин, L-Валин, L-Изолейцин

Вес

250 г

В одной порции (3 каплеты) содержится:

Аминокислоты

3 г

Жиры

0,03 г

Углеводы

0,03 г

Энергетическая ценность

12 ккал / 50 кДж

Витамины

Аминокислотный профиль

L-Лейцин, L-Валин, L-Изолейцин

3 г

Состав

L-лейцин, L-изолейцин, L-валин, крахмал картофельный, стеарат магния – эмульгатор, пиридоксин гидрохлорид, диоксид титана — краситель, полиэтиленгликоль -глазирователь, тальк — антислеживающий агент, гидроксипропилметилцеллюлоза — стабилизатор.

Показания к применению

Взрослым принимать по 3-6 каплет (таблетки в форме капсулы, облегчающей глотание целиком) перед и сразу после тренировки.

Условия хранения

В сухом месте при температуре не выше +25°С.

Журнал «Вопросы наркологии» — 2017 год, выпуск 10 — Новости

Журнал «Вопросы наркологии» — 2017 год, выпуск 10


Журнал «Вопросы наркологии» — №10, 2017

 

Содержание

КЛИНИЧЕСКИЕ АСПЕКТЫ НАРКОЛОГИИ

Клименко Т.В., Игонин А.Л., Кулагина Н.Е.

Клинический патоморфоз алкогольного опьянения: диагностика и причинные факторы. С. 5–15

На материале 156 подэкспертных судебно-психиатрической клиники проанализированы клинико-динамические особенности алкогольного опьянения. Показано, что клинический динамический патоморфоз алкогольного опьянения определяется комплексом клинических, биологических и социальных факторов, основное значение среди которых имеет прогредиентное развитие расстройств алкогольного спектра. Также показано, что клиническая динамика алкогольного опьянения сопровождается появлением психических расстройств более глубокого уровня поражения психической деятельности, что проявляется последовательной сменой аффективного, эмоционально-волевого и органического вариантов атипичного алкогольного опьянения.

Ключевые слова: простое и атипичное алкогольное опьянение, опьянение ПАВ, уголовно релевантное опьянение ПАВ.

 

Мурина И.В., Мавани Д.Ч., Булейко А.А., Крысенко П.Б., Ковалев А.И., Крючкова М.Н., Денисенко И.А., Симак О.Я.

Компьютерная зависимость: патопсихологические синдромы. С. 16–34

Работа посвящена компьютерной зависимости в ее патопсихологическом аспекте. Методы исследования: клинический, психологический, статистический. Авторы разделили основную группу больных, страдающих компьютерной зависимостью, на 2 подгруппы – первичную и сочетанную (сочетание с другим психическим расстройством). Психологическое исследование позволило разделить подгруппы на специфические подгруппы. В группах сравнения выявлены статистически значимые различия. Описанные патопсихологические характеристики имеют не только теоретическую, но и практическую значимость – как в диагностике расстройства, так и в последующем оказании помощи страдающим компьютерной зависимостью.

Ключевые слова: компьютерная зависимость, патопсихологические синдромы, коморбидность.

 

РЕГИОНАЛЬНЫЕ АСПЕКТЫ НАРКОЛОГИИ

Волков А.В., Шмелев А.Г., Комаров А.А., Темиргалиева М.М., Зеркалина Е.И.

Интегративный подход как основа стационарной реабилитации в наркологии: опыт Ярославской области. С. 35–52

В статье рассмотрены различные аспекты психосоциальной реабилитации лиц, зависимых от употребления ПАВ. Дано описание современных подходов к организации реабилитационного процесса. Предложена модель создания психосоциальной реабилитации лиц, зависимых от употребления ПАВ, в рамках интегративного подхода. Данный подход способствует повышению качества лечебно-реабилитационной помощи наркологическим больным.

Ключевые слова: психосоциальная реабилитация, зависимость от употребления ПАВ, реабилитационный процесс, системность, модель психосоциальной реабилитации, интегративный подход, двенадцати-шаговая программа.

 

БИОМЕДИЦИНСКИЕ АСПЕКТЫ НАРКОЛОГИИ

Сахаров А.В., Голыгина С.Е., Терешков П.П.

Динамика некоторых показателей эндотелиальной дисфункции и нейромаркеров у больных алкогольной зависимостью при синдроме отмены алкоголя, неосложненном и осложненном делирием. С. 53–63

Исследованы показатели эндотелиальной дисфункции и маркеры «нейродеструкции-нейрорепарации» у пациентов с алкогольной зависимостью при синдроме отмены алкоголя неосложненном и осложненном делирием. Установлены выраженные изменения функции эндотелия, выражающиеся в повышении уровня E-селектина и эндотелина (1-21), которые сопровождаются существенным повышением содержания показателей нейродеструкции (GFAP, NR2 antibody) с одновременным компенсаторно-защитным усилением образования мозгового нейротрофического фактора BDNF. Более выраженные изменения наблюдаются при алкогольном делирии. Устранение проявлений синдрома отмены алкоголя через 2 недели терапии сопровождается снижением показателей эндотелиальной дисфункции и нейромаркеров, однако полной нормализации величины исследованных параметров не наблюдается.

Ключевые слова: алкоголизм, синдром отмены алкоголя, эндотелиальная дисфункция, нейромаркеры, E-селектин, эндотелин, GFAP, NR2 antibody, BDNF.

 

Лелевич В.В., Виницкая А.Г., Лелевич С.В., Шейбак В.М., Смирнов В.Ю.

Коррекция пула свободных аминокислот в тканях крыс при прерывистой морфиновой интоксикации. С. 64–75

В работе исследовали состояние пула свободных аминокислот в периферических тканях крыс (печень, скелетная и сердечная мускулатура) при прерывистой морфиновой интоксикации и введении на ее фоне двух аминокислотных композиций. Введение морфина в прерывистом режиме привело к снижению в печени соотношения «аминокислоты с разветвленной углеводородной цепью: ароматические аминокислоты», изменению уровней шести аминокислот. В скелетной и сердечной мускулатуре изменения пула свободных аминокислот были менее выражены. Композиция №1 (L-валин, L-изолейцин, L-лейцин, таурин), вводимая в свободные от морфина периоды времени, устраняла последствия морфиновой интоксикации в печени, нормализовала уровень орнитина в скелетной мускулатуре. Действие композиции №2 (L-триптофан, L-аргинин-L-аспартат, глицин) при прерывистой морфиновой интоксикации было выражено в меньшей степени и сопровождалось уменьшением содержания глутамата и аргинина в печени.

Ключевые слова: пул свободных аминокислот, прерывистая морфиновая интоксикация, композиции аминокислот, печень, скелетная и сердечная мускулатура.

 

ЭПИДЕМИОЛОГИЧЕСКИЕ АСПЕКТЫ НАРКОЛОГИИ

Немцов А.В.

Праздник – фактор риска алкогольных психозов. С. 76–88

Уже неоднократно и в разных точках страны выявлялся максимум заболеваемости алкогольными психозами (АП) в январе. Предпринята попытка детального исследования этого явления. Материалом исследования послужили данные о ежедневном или месячном количестве случаев АП, которые госпитализированы скорой помощью Москвы с 1 января 2000 г. по 30 августа 2015 г. За это время служба зарегистрировала 129 551 случаев АП. Главный метод обработки ежедневных данных – усреднение числа АП до, во время и после основных праздничных дней (1 января, 23 февраля, 8 марта и 1 мая) с привязкой анализа к этим дням. Использовались также рутинные статистические методы. Анализ АП выявил особую тяжесть алкогольной ситуации в январе, и это требует переломить ситуацию и снизить урон, который выходит далеко за пределы АП и других алкогольных диагнозов.

Ключевые слова: алкогольные психозы, новогодне-рождественские праздники, заболеваемость в январе.

 

Евдокимов А.Г., Оруджев Н.Я., Кузнецов Д.В.

Скрининговое исследование распространенности проблемного потребления алкоголя по районам города Волгограда. С. 89–97

В настоящей статье обсуждаются результаты скрининга распространенности проблем, связанных с потреблением алкоголя среди жителей районов г. Волгограда с помощью теста AUDIT. В исследовании принимало участие 2100 респондентов (1465 мужчин и 635 женщин). Согласно результатам скрининга, была установлена доля лиц с опасным уровнем потребления алкоголя с вредными последствиями (9,2 ± 3,7%) и доля лиц с уже сформированным синдромом зависимости от алкоголя (13,6 ± 6,4%). Таким образом, результаты настоящего исследования свидетельствуют о высоком уровне проблем, связанных с потреблением алкоголя среди населения города, и актуальности проведения профилактических мероприятий, направленных на снижение потребления алкоголя.

Ключевые слова: алкогольные проблемы, скрининг, тест AUDIT.

 

ОБЗОРЫ

Анцыборов А.В., Ненастьева А.Ю.

Новые психоактивные вещества – фенилэтиламины группы 2с: избранные вопросы клиники, фармакологии, лечения. С. 98–109

Вещества семейства 2С представляют собой психоделики с замещенным кольцом, структурно схожие с 3,4-метилендиокси-N-метиламфетамином (MDMA, экстази). Знание структуры данного семейства новых психоактивных веществ (НПАВ), имеет огромное значение для специалистов. В настоящем обзоре, на основе анализа имеющейся литературы, основное внимание уделено фармакологии, фармакокинетике, клиническим эффектам, возникающим при употреблении 2С-веществ, лечебной тактике при острой интоксикации.

Ключевые слова: 2С, фенилэтиламины, галлюциногены, дизайнерские наркотики, новые психоактивные вещества, фармакология, острая интоксикация, фармакокинетика, лечебная тактика.

 

СОЦИАЛЬНЫЕ АСПЕКТЫ НАРКОЛОГИИ

Хапепхова А.Р.

Актуальные проблемы организации проведения медицинского освидетельствования на состояние опьянения водителей транспортных средств в Республике Адыгея. С. 110–114

Статья посвящена обзору основных проблем нормативного регулирования подтверждения состояния опьянения (алкогольного, наркотического или иного токсического) водителя транспортного средства, возникающих в практической деятельности Адыгейского республиканского наркологического диспансера.

Ключевые слова: медицинское освидетельствование, химико-токсикологические исследования, подтверждение состояния опьянения водителя (алкогольного, наркотического или иного токсического), дорожно-транспортное происшествие, автодорожный травматизм.

 

МАТЕРИАЛЫ КОНФЕРЕНЦИЙ

Бурцев А.А., Фадеева Е.В.

Психология дорожного движения: вопросы теории и практики.
Обзор материалов Первой международной научно-практической конференции в Московском государственном психолого-педагогическом университете 26 мая 2017 г. С. 116–126

В настоящей статье представлены материалы Первой международной научно-практической конференция «Психология дорожного движения: вопросы теории и практики», проходившей 26 мая 2017 г. в Московском государственном психолого-педагогическом университете и посвященной ознакомлению с опытом профилактики в области безопасности дорожного движения ведущих зарубежных дорожных психологов стран Европейского Союза. Предложена интеграция практического опыта дорожных психологов в рамках межведомственной модели профилактики управления транспортным средством в состоянии опьянения в России.

Ключевые слова: дорожный психолог, безопасность дорожного движения, дорожно-транспортное происшествие (ДТП), транспортное средство, алкогольное опьянение, «пьяные» ДТП.

Вложения:

Страницы 5-15 из VN10.pdf (152.73 kb.)

Тэги:

журнал «Вопросы наркологии» (38)

Торрокс Torroks

ИНСТРУКЦИЯ ПО ПРИМЕНЕНИЮ

«ТОРРОКС»

(аминокислоты 5%  с сорбитол 5%)

 

Торговое название: «ТОРРОКС»                                                                                                                                        Международные непатентованное название: нет                                                                                                     Лекарственная форма: Раствор для инфузий                                                                                                                                      

Состав:

Состав: каждые 100 мл содержат:

 

L-ПРОЛИН                                       

 0. 10 г

L-СЕРИН                                        

 0.10 г

L-АЛАНИН                                     

 0.20 г

L-ИЗОЛЕЙЦИН                              

 0.352 г

L-ЛЕЙЦИН                                       

0.49 г

L-АСПАРАГИНОВАЯ КИСЛОТА    

 0.25 г

L-ТИРОЗИН                                  

 0.025 г

L-ГЛЮТАМИНОВАЯ КИСЛОТА   

 0.075 г

L-ФЕНИЛАЛАНИН                       

 0. 533 г

L-АРГИНИН                                    

0.50 г

L-ЛИЗИНА ГИДРОХЛОРИД         

 0.43 г

L-ВАЛИН                                         

0.36 г

L-ТРЕОНИН                                    

 0.25 г

L-ГИСТИДИН                                   

0.25 г

L-ТРИПТОФАН                               

 0.09 г

L-МЕТИОНИН                                

0. 225 г

L-ЦИСТИН                                       

0.01 г

ГЛИЦИН                                         

 0.76 г

СОРБИТОЛ                                      

5.00 г

МЕТАБИСУЛЬФИТ НАТРИЯ          

0.02 г

ГИДРОКСИД НАТРИЯ                    

0.14 г

ВОДА ДЛЯ ИНЪЕКЦИЙ   в достаточном   количестве

 

 

Описание                                                                                                                                                                                Прозрачный, бесцветный или бледно-желтый раствор

Фармакотерапевтическая группа.

Препарат для парентерального питания

Фармакологическое действие                                                                                                      «ТОРРОКС» предназначен для парентерального питания больных с различной патологией с низкой, нормальной или повышенной потребностью в белке, когда энтеральное питание неэффективно или невозможно. Содержащиеся в «ТОРРОКС» заменимые и незаменимые L-аминокислоты являются природными физиологическими соединениями. Как и аминокислоты, поступающие с пищей и получаемые путем расщепления белков, парентерально вводимые аминокислоты поступают в общий пул свободных аминокислот плазмы крови, и из него в клетки для синтеза белков и в различные метаболические пути.                                                                                                          Все аминокислоты находятся в L–форме, что обеспечивает возможность их прямого участия в биосинтезе белков. Содержит все восемь незаменимых аминокислот, а также условно заменимые L–аргинин и L–гистидин. L–аргинин способствует превращению аммиака в мочевину, связывает токсичные ионы аммония, которые образуются при катаболизме белков в печени.                                                                                                                                                          Главным источником энергии в этих препаратах служит сорбитол, который фосфорилируется в печени во фруктозо-6-фосфат. В усвоении сорбитола и фруктозы инсулин не принимает участие, что делает их инсулин-независимыми источниками энергии — при их применении не возникает гипергликемический ацидоз, который может встречаться при использовании для парентерального питания препаратов, содержащих глюкозу. Кроме того, сорбитол является лучшим растворителем аминокислот, чем глюкоза, поскольку не содержит альдегидных и кетоновых групп, не взаимодействует с аминогруппами и не снижает усвояемость аминокислот.

Оптимальное соотношение заменимых и всех незаменимых аминокислот обеспечивает хорошие условия для купирования воспалительных процессов, репаративной регенерации поврежденных тканей, улучшения функционального состояния систем жизнеобеспечения.                                                                                                                                                     Фармакокинетика                                                                                                                                                                    Вводимые парентерально аминокислоты используются в организме в процессе синтеза белка. Не использованные в этом процессе аминокислоты подвергаются дезаминации с образованием мочевины, которая затем выходит с мочой. T1/2 аминокислот (у здоровых людей) составляет 5–15 минут. При быстром увеличении концентрации аминокислот в крови, они могут выходит с мочой не усвоившись организмом, не успевая биотрансформироваться.
«ТОРРОКС»  в организме биотрансформируется в фермент флавинмононуклеотид, а затем в флавинадениндинуклеотид. Метаболиты «ТОРРОКС»  на 60% связываются с белками плазмы. «ТОРРОКС »  выделяется с мочой, частично в форме метаболитов

Показания к применению

полное или частичное парентеральное питание,

восполнение белков, потери жидкости и электролитов при невозможности энтерального питания,

профилактика и терапия состояния белкового дефицита различного генеза (при ожогах, операциях, потере крови).

тяжелые случаи гастроинтестинальных заболеваний (непроходимость кишечника, перитонит, синдром мальабсорбции, кишечные свищи, воспалительные заболевания тонкого кишечника, панкреатит)

другие случаи, требующие парентерального питания (злокачественные опухоли, до и после хирургических вмешательств)

 Способ применения и дозировка препарата:                                                                                                                     Устанавливают индивидуально с учетом состояния пациента.                                                                                    Дозировка должна быть назначено согласно требованию аминокислоты в зависимости от возраста, массы тела и состояния пациента.
Взрослым:

0.6-1.0 г аминокислот/кг массы тела/сут.

При состояниях с преобладанием катаболизма:

1.3-2.0 г аминокислот/кг/сут.

Максимальная суточная доза: 2 г аминокислот/кг.

У взрослых при лечении с использованием парентерального питания объем общего количества жидкости не должен превышать 40 мл/кг/сут.

Детям (в т.ч. детям грудного возраста):

1.5-2.5 г аминокислот/кг/сут.

Объем вводимого «ТОРРОКС»  уменьшается соответственно количеству жидкости и калорий, вводимых энтерально.

 Побочное действие лекарства                                                                                                                        Пищеварительная система: повышение активности ферментов печени.
Местные реакции: раздражение кожи в месте введения препарата, тромбофлебит.
Аминокислоты могут вызывать изменение состава крови и повышение содержания аммиака в крови.
Возможно возникновение тошноты, рвоты, болей в животе, чувства усталости, крапивницы, артериальной гипертензии, тахикардии, парестезий, нарушений дыхания, повышения потоотделения и температуры тела. Противопоказания к применению

   – нарушение синтеза протеинов;
– выраженные нарушения функции почек;
– выраженные нарушения функции печени;
– тяжелые формы сердечной недостаточности;
– непереносимость фруктозы;
– отравление метанолом;
– гиперкалиемия;
– ацидоз.

Применение во время беременности и кормления грудью:                                                                                     Данные о возможности применения препарата «ТОРРОКС» при беременности и в период кормления не предоставлены.                                                                                                                                                                 Особые указания:                                                                                                                                                                              При печеночной и почечной недостаточности требуется индивидуальная дозировка.

При печеночной и почечной недостаточности, ацидозе, шоке препарат применяют только после достижения адекватного диуреза.

При использовании «ТОРРОКС» требуется контроль водно-электролитного баланса, концентрации глюкозы в крови, кислотно-щелочного равновесии.

Для полного парентерального питания необходимо одновременное введение растворов, содержащих жиры, углеводы, электролиты, витамины и микроэлементы.

В связи с повышенным риском микробной контаминации и несовместимости, растворы, содержащие аминокислоты, не следует смешивать с другими лекарственными средствами.

 Взаимодействие с другими лекарствами:                                                                                                                        Одновременное введение аргинина с тиазидными диуретиками и аминофиллином увеличивает содержание инсулина в крови.
При одновременном применении аргинина со спиронолактоном возможна тяжелая гиперкалиемия. При совместном применении изониазид, пеницилламин, пероральные контрацептивы снижают метаболизм пиридоксина. При одновременном применении «ТОРРОКС» значительно уменьшает активность доксициклина, тетрациклина, окситетрациклина, эритромицина и линкомицина.                               

Фармацевтическое взаимодействие:

Несовместим с другими лекарственными средствами (не следует бесконтрольно смешивать с другими лекарственными средствами). При введении препарата следует учитывать, что аргинин не совместим с тиопенталом.

Срок годности

2 года

Условия хранения

В защищенном от света месте при температуре не выше 25° С.

Не замораживать.

Форма выпуска:                                                                                                                                                                    В стеклянных флаконах по 100мл, 200мл и 500мл, укупоренных резиновыми пробками, алюминиевыми колпачками под обкатку                                                                                                                                                                                      Производитель:
Jiangsu Pengyao Pharmaceutical Co.,Ltd
10 Chayuan Road, Yixing, China

 

 

 

Изолейцин: чем полезен | Nutrifit.

ru

Как известно изолейцин является одной из незаменимых аминокислот, которая не синтезируется нашим организмом и не восполняется. О значении такого вещества знает буквально каждый спортсмен, ставящий перед собой высокие цели в спортивной сфере. В чем заключаются ее преимущества и главное значение, рассмотрим более подробно в материале. 

Особенности аминокислоты

Прежде всего, изолейцин принимает активное участвует в синтезе гемоглобина. Функция аминокислоты заключается в том, что она обеспечивает присоединение большого количества клеток кислорода к гемоглобину. Все это способствует ускорению транспортировки крови, что становится следствием повышением увеличения выносливости организма. 

Во-вторых, изолейцин отвечает за регуляцию уровня сахара в крови. Всем известно, что перенасыщение, так же как и нехватка глюкозы отрицательно воздействует на организм. К слову сказать, за регуляцию уровня сахара в крови отвечают гормоны, основу которых составляют как раз-таки невосполнимые аминокислоты, среди которых весомое место занимает изолейцин. Именно он активно принимает участие в выработке инсулина. Поэтому его недостаток может привести к нарушению углеводного обмена. 

В-третьих, изолейцин замечен в нормализации процессов энергообеспечения. Посредством синтеза аланина изолейцин создает условия для ускоренного восстановления мышечных клеток. 

В-четвертых, изолейцин укрепляет эпидермис (поверхностный слой кожи). Как известно, от уровня аминокислот в крови зависят не только обменные процессы, но и состояние эпидермиса. Другими словами, чем выше содержание аминокислот, тем активнее осуществляется обмен веществ и восстановление. 

Как применим изолейцин в спорте

Если вы постоянно тренируетесь с использованием значительных нагрузок, там вам просто не обойтись без изолейцина. Речь идет о бодибилдинге, пауэрлифтинге и различных циклических видах спорта, где необходима выносливость и колоссальные энергетические затраты. Дело в том, что изолейцин как раз обеспечивает организм всем этим в необходимом количестве. Кроме того, если изолейцин употреблять в паре с другими аминокислотами, то таким образом вы сможете защитить мышцы от разрушительных процессов. Так, изолейцин гармонично сочетается с валином и лейцином. В результате получается всем нам знакомые аминокислоты ВСАА. Помимо прочего большое количество изолейцина находится в яйцах, рыбе и сыре. 

Сколько употреблять

Лучше всего изолейцин употреблять вместе с двумя другими незаменимыми аминокислотами: валином и лейцином. Важно соблюдать пропорцию 1:1:2. Оптимальным временем приема считается до и после тренировки. Одна порция должна равняться не больше 10-15 грамм. 

Исходя из сказанного, изолейцин необходим нашему организму постоянно. Тем более, если вы активно занимаетесь физическими нагрузками и работаете с тяжелыми весами. Особенно эта аминокислота эффективна во время набора мышечной массы. В то же время изолейцин помогает сохранить мышечные клетки во время сброса веса. Употребляйте изолейцин, соблюдайте диету и занимайтесь спортом, и вы в этом случае добьетесь положительных результатов.  

Лейцин аминокислота — для чего она нужна

Лейцин в бодибилдинге как принимать. Что такое лейцин для чего он нужен и его свойства

Использование лейцина в спорте и в бодибилдинге

Лейцин что это такое — одна из трёх аминокислот с разветвлёнными боковыми цепочками (ВСАА). Эта аминокислота наиболее важная и часто встречающаяся в комплексах аминокислот ВСАА. В меньшем количестве она содержится в концентратах сывороточного протеина.

Для спортсменов лейцин выполняет важную роль в создании новых мышечных тканей в организме, способствует увеличению синтеза белка. В то же время лейцин подавляет разрушение белковых молекул, что очень важно для мышечного роста. Таким образом, можно уменьшить распад белков после интенсивных тренировок при увеличении потребления лейцина.

Лейцин немаловажен и в процессах получения энергии. Он косвенно экономит запасы глюкозы и подавляет их разрушение. Аминокислота лейцин предотвращает мышечный катаболизм. Другие аминокислоты с разветвленными боковыми цепями, изолейцин и валин, служат в первую очередь как субстрат для глюконеогенеза и также проявляют, таким образом, свой антикатаболический эффект. По этой причине комбинированный прием всех трех этих аминокислот особенно эффективен. См. BCAA.

Метаболизм лейцина стимулирует рост мышц и одновременно подавляет дальнейшую потерю мышечной массы.

Еще одним анаболическим свойством лейцина является его способность стимулировать секрецию инсулина. Лейцин обладает наибольшим инсулиногенным эффектом по сравнению с двумя другими аминокислотами BCAA (изолейцином и валином). Повышени/sportivnoe-pitanie/aminokislotyе уровня инсулина в плазме крови уменьшает секрецию катехоламинов и кортизола, обладающих выраженным катаболическим действием.

Кортизол, в отличие от инсулина, выполняющего задачу хранения и накопления питательных веществ, ответственен за процессы их разрушения и выделения энергии. Это гормон обладает выраженным катаболическим действием на мышцы. Очевидно, что постоянно повышенный уровень кортизола очень негативно влияет на количество мышечной ткани.

Особенно это опасно для тех спортсменов, которые тренируются часто и интенсивно, сидят на низкоуглеводной диете. В этом случае можно извлечь определенную выгоду от приема лейцина, употребляя его перед и сразу после тренировки.

Для тех атлетов, кто все равно принимает после тренировки много углеводов, инсулин-стимулирующий эффект лейцина менее интересен. Однако и эти спортсмены не проиграют от его приема, так как у лейцина есть и другие положительные свойства.

Видео: Как работает лейцин в бодибилдинге

Исследования лейцина. Что такое лейцин

Испытания на животных показали, что добавки с лейцином не только стимулируют рост мышечной ткани, но и усиливают синтез коллагена. Лейцин также может способствовать укреплению суставов. Эпидемиологические исследования показывают, что высокий уровень лейцина уменьшает риск избыточных жировых отложений.

Лейцин что это такое!? Это — довольно интересное вещество. Исследование, опубликованное в 2007 году в журнале «Diabetes» вскрывает ещё более интересные его грани. В этом исследовании учёные проводили эксперимент на мышах. Половина животных получала обычное питание, а вторая получала избыточное количество жира. Половина мышей из каждой группы получала 55 мг дополнительного лейцина в день с питьевой водой. Это в два раза превышает суточную дозу лейцина.

Эксперимент длился 15 недель. За этот период мыши, принимавшие высокое количество жира, стали толще. Но у мышей из группы, которые получали повышенное количество лейцина, увеличение жировой массы оказалось на четверть меньше.

Когда исследователи провели мониторинг расхода кислорода мышами в течение дня, они обнаружили, что мыши, принимавшие лейцин, потребляли большее количество кислорода. Это означает, что мыши в результате сожгли больше калорий. Таким образом, лейцин ингибирует процесс жировых отложений.

Анализ мышц и белых жировых клеток лабораторных животных показали, что дополнительный приём лейцина усиливает синтез UCP3 (ген разобщающего белка 3). Этот ген усиливает жиросжигающую способность митохондрий, он разделяет процессы утилизации пищевых калорий и производства АТФ.

Исследователи из «Pennsylvania State University» в 2009 году повторили этот эксперимент, но с использованием меньших дозировок лейцина. Как оказалось, приём меньших доз не дал существенного эффекта.

Как принимать лейцин в бодибилдинге. (BCAA)

Не надо принимать л лейцин в изолированном виде по несколько раз в день. Это может привести к нарушению белкового обмена и совсем не тому результату, на который вы рассчитываете. Принимайте совместно с изолейцином и валином в качестве BCAA.

Для достижения максимального антикатаболического эффекта лейцина или BCAA рекомендуется принимать 5-10 г до тяжелой тренировки и/или пить во время тренировки.

Для достижения выраженного анаболического эффекта лейцина его следует принимать после тренировки в течение 40 минут, также 5-10 г. Это особенно полезно спортсменам, которые ограничивают прием углеводов.


Аминокислоты

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Характеристика l-изолейциндиоксигеназы Bacillus thuringiensis для производства полезных аминокислот

РЕФЕРАТ

Мы определили ферментативные характеристики промышленно важного биокатализатора, α-кетоглутарат-зависимой l-изолейциндиоксигеназы (IDO), которая оказалась фермент, ответственный за образование (2 S , 3 R , 4 S ) -4-гидроксиизолейцина в Bacillus thuringiensis 2e2. В зависимости от аминокислоты, используемой в качестве субстрата, IDO катализирует три различных типа реакций окисления: гидроксилирование, дегидрирование и сульфоксидирование. IDO стереоселективно гидроксилировал несколько гидрофобных алифатических 1-аминокислот, а также 1-изолейцин, и продуцировал ( S ) -3-гидрокси-1- алло -изолейцин, 4-гидрокси-1-лейцин, ( S ) -4-гидрокси-1-норвалин, 4-гидрокси-1-норлейцин и 5-гидрокси-1-норлейцин. Продукт реакции IDO 1-изолейцина, (2 S , 3 R , 4 S ) -4-гидроксиизолейцин, снова подвергался взаимодействию с IDO и дегидрировался до (2 S , 3 R ) — 2-амино-3-метил-4-кетопентаноат, который также является метаболитом, обнаруженным в B.thuringiensis 2e2. Интересно, что IDO катализирует сульфоксидирование некоторых серосодержащих 1-аминокислот и дает сульфоксид 1-метионина и сульфоксид 1-этионина. Следовательно, эффективное производство различных модифицированных аминокислот станет возможным с использованием IDO в качестве биокатализатора.

ВВЕДЕНИЕ

Гидроксиаминокислоты — это необычные гидроксилированные аминокислоты, встречающиеся в природе повсеместно. Они существуют как вторичные метаболиты и компоненты пептидов и белков. Свободные аминокислоты в основном содержатся в высших растениях (3, 29), а также в моче человека был обнаружен свободный трео, -3-гидрокси-1-аспарагин (25) и свободный 3-гидрокси-1-валин. выделен из гриба Pleurocybella porrigens (1).Альтернативно, многие гидроксиаминокислоты являются компонентами гликопептидных антибиотиков, таких как ванкомицин (30), блеомицин (35) и рамопланин (7), и циклодепсипептидов, таких как политеонамиды (14) и папуамиды (10), а также коллагена. (13). Известно, что эти пептиды, содержащие остатки гидроксиаминокислот, обладают противогрибковой, антибактериальной, противовирусной и противораковой активностью. Некоторые гидроксиаминокислоты имеют несколько хиральных атомов углерода и могут быть важны в качестве предшественников и хиральных вспомогательных веществ в химическом синтезе других соединений (4, 26).

В частности, (2 S , 3 R , 4 S ) -4-гидрокси-1-изолейцин (HIL), который впервые был обнаружен в семенах пажитника (12), является перспективным соединением для лекарственных препаратов. и функциональные продукты из-за их антидиабетической активности (5, 6) и активности против ожирения (15). В нашем предыдущем исследовании было обнаружено, что Bacillus thuringiensis 2e2 обладает новым метаболическим путем l-изолейцина (l-Ile), включающим гидроксилирование l-Ile до (2 S , 3 R , 4 S ) — HIL и дальнейшее окисление до (2 S , 3 R ) -2-амино-3-метил-4-кетопентаноат (AMKP), который известен как антиметаболит витамина B 12 (27).Первая реакция пути катализируется α-кетоглутарат (αKG) -зависимой l-Ile-диоксигеназой (IDO) (18), а вторая — NAD + -зависимой HIL-дегидрогеназой (23). Кроме того, мы разработали эффективную систему продукции для HIL с использованием клеток Escherichia coli, гетерологично экспрессирующих IDO (31).

Ферменты, принадлежащие к суперсемейству αKG-зависимых диоксигеназ, в первую очередь катализируют гидроксилирование широкого спектра малых молекул, сопровождаемое окислительным декарбоксилированием αKG в сукцинат (16). Известно, что несколько αKG-зависимых диоксигеназ могут гидроксилировать свободные аминокислоты. Среди них 1-пролин-4-гидроксилаза (19), 1-пролин-3-гидроксилаза (22), 1-аспарагин-3-гидроксилаза (AsnO) (34) и l-аргинин-3-гидроксилаза (VioC) (37). все они обнаружены у видов Streptomyces и хорошо охарактеризованы. IDO является первым ферментом, обладающим активностью гидроксилирования C-4 по отношению к свободной алифатической аминокислоте, и поэтому важно исследовать способность этой новой диоксигеназы находить различные применения, такие как фармацевтические промежуточные продукты, функциональные пептиды и контрольные молекулы эукариотических организмов. экспрессия гена.

В этом исследовании мы исследовали IDO, чтобы определить его кинетические константы и субстратную специфичность по отношению к аминокислотам и их производным. Интересно, что IDO катализирует три типа реакций окисления: стереоселективное гидроксилирование различных гидрофобных алифатических l-аминокислот, дегидрирование (2 S , 3 R , 4 S ) -HIL в (2 S , 3 R ) -AMKP и сульфоксидирование некоторых серосодержащих l-аминокислот; эти результаты могут быть полезны для промышленного производства оптически активных аминокислот, а также (2 S , 3 R , 4 S ) -HIL.

МАТЕРИАЛЫ И МЕТОДЫ

Получение очищенного рекомбинантного IDO. Штамм E. coli Rosetta2 (DE3), экспрессирующий IDO с 6 × His-меткой, несущий pET-IDO (2e2), был сконструирован способом, аналогичным методу, описанному в нашем предыдущем отчете ( 23), за исключением использованного набора праймеров: CATATGAAAATGAGTGGCTTTAGCATAGAA и CTCGAGTTTTGTCTCCTTATAAGAAAATGT. Рекомбинантный IDO был гетерологично экспрессирован в штамме и очищен таким же образом, как и в предыдущем отчете (23). После проверки однородности методом SDS-PAGE (см. Рис.S1 в дополнительном материале) очищенный IDO использовали для дальнейшей характеристики.

Условия реакции для IDO. Для каталитической характеристики гидроксилирования l-Ile с помощью IDO реакционная смесь состояла из 10 мМ l-Ile, 10 мМ αKG, 0,5 мМ FeSO 4 · 7H 2 O, 10 мМ аскорбиновой кислоты. кислоты, 50 мМ бис-трис (pH 6,0) и 0,2 мг / мл очищенного рекомбинантного IDO, и реакции позволяли протекать при 25 ° C в течение 10 мин. Для определения значений K m , l-Ile и αKG использовались при концентрациях 0.От 02 до 5 мМ и от 0,01 до 1 мМ соответственно. Ферментативную активность измеряли аминокислотным анализом. Для анализа субстратной специфичности IDO реакционная смесь состояла из 2 мМ субстрата, 10 мМ αKG, 0,5 мМ FeSO 4 · 7H 2 O, 10 мМ аскорбиновой кислоты, 50 мМ бис-триса (pH 6,0) и 0,2 мг / мл очищенного рекомбинантного IDO, и реакции давали возможность протекать при 25 ° C в течение 10 мин. Ферментативную активность определяли как продукцию янтарной кислоты, измеренную спектрометрически с помощью набора F (Roche Diagnostics, Базель, Швейцария).

Условия анализа аминокислот с помощью ВЭЖХ. Аминокислоты были дериватизированы с использованием метода AccQ-Tag (Waters, Milford, MA). Производные аминокислот анализировали с использованием системы высокоэффективной жидкостной хроматографии (ВЭЖХ) Alliance 2695 (Waters), снабженной детектором флуоресценции. Колонку XBridge C 18 (5 мкм; 2,1 х 150 мм; Waters) использовали для разделения при 40 ° C. Подвижные фазы представляли собой 10 мМ ацетат аммония при pH 5,0 (элюент A) и метанол (элюент B), скорость потока элюента составляла 0.3 мл / мин. Градиенты элюента составляли от 0 до 1% (об. / Об.) B в течение 0–0,5 мин, от 1 до 5% B в течение 0,5–18 мин, от 5 до 9% B в течение 18–19 мин, от 9 до 17% B для 19–19 мин. 29,5 мин, от 17 до 60% B от 29,5 до 40 мин и 60% B от 40 до 43 мин.

Условия анализа жидкостной хроматографией / электрораспылительной ионизацией-масс-спектрометрией (LC / ESI-MS). Продукты реакции IDO анализировали с помощью LCMS-2010A (Shimadzu, Kyoto, Japan). Колонку TSKgel Amide-80 HR (4,6 мм на 250 мм; Tosoh, Tokyo, Japan) использовали для разделения при 40 ° C.Подвижная фаза представляла собой 1,5 мМ ацетат аммония (pH 5,0) в 85% ацетонитриле, скорость потока составляла 1 мл / мин. Условия МС были следующие: температура блока 200 ° C; кривая линия десольватации (CDL) температура 250 ° C; напряжение детектора 1,5 кВ; расход распыляющего газа 1,5 л / мин.

Идентификация аминокислотных продуктов в реакции IDO. Препаративное выделение аминокислот, продуцируемых в реакционной смеси IDO, проводили с помощью системы Alliance 2695 HPLC (Waters), оснащенной УФ-детектором.Колонку TSKgel Amide-80 (7,8 мм на 300 мм; Tosoh) использовали для разделения при 40 ° C. Подвижная фаза представляла собой 1,5 мМ ацетат аммония (pH 5,0) в 85% ацетонитриле, скорость потока составляла 2 мл / мин. Аминокислоты детектировали с использованием УФ-поглощения при 210 нм. Каждый элюат, содержащий выделенную аминокислоту, сушили вымораживанием и растворяли в D 2 О. Спектры протонного ядерного магнитного резонанса ( 1 H-ЯМР) записывали на Avance 500 (Bruker, Billerica, MA).

РЕЗУЛЬТАТЫ

Каталитические свойства рекомбинантного IDO.Каталитические параметры гидроксилирования l-Ile измеряли с использованием очищенного рекомбинантного IDO. Оптимальные условия реакции для реакции рекомбинантной IDO были pH 6,0 и 25 ° C. Хотя оптимальный pH реакции рекомбинантного IDO был таким же, как у нативной формы IDO, очищенной из клеток B. thuringiensis 2e2, его оптимальная температура реакции была на 5 ° C ниже, чем у нативной формы (18). Добавление тега 6 × His к С-концу IDO может, таким образом, влиять на его термостабильность.Нормальная гиперболическая кинетика наблюдалась с l-Ile в реакции рекомбинантной IDO. Обработка данных Лайнуивером-Берком дала очевидные значения K m для l-Ile 0,27 мМ и для αKG 0,23 мМ, а для V max было 1,13 мкмоль · мин -1 · мг −1 .

Субстратная специфичность IDO. Рекомбинантный белок IDO был очищен и прореагировал с различными видами аминокислот: 20 протеиногенными l-аминокислотами, небелковыми l-аминокислотами и d-образными аминокислотами и производными аминокислот, такими как N -замещенные аминокислоты, сложные эфиры аминокислот и т. д.Когда некоторые l-формы аминокислот, включая l-лейцин, l-норлейцин, l-норвалин, l- алло -Ile, (2 S , 3 R , 4 S ) -HIL, l- метионин, l-этионин, l-цистеин и dl-гомоцистеин использовались в качестве субстратов, IDO показала сукцинат-генерирующую активность, а также l-Ile. Начальные скорости реакции для этих субстратов приведены в таблице 1. С другой стороны, не наблюдалось образования сукцината в реакционной смеси IDO с использованием любых d-форм аминокислот и производных аминокислот, таких как N -замещенные аминокислоты. и сложные эфиры аминокислот в качестве субстрата.В частности, что касается соединений, структурно связанных с l-Ile, IDO не реагирует с d-Ile, d- алло -Ile, трет -бутоксикарбонил (Boc) -1-Ile, 9-флуоренилметоксикарбонил (Fmoc) -l. -Иле, N, -карбамоил-1-Иле, метиловый эфир 1-Иле и метиловый эфир N -ацетил-1-Иле, но он действительно реагировал с 1- алло -Иле.

Таблица 1.

Субстратная специфичность IDO

Анализ продуктов реакции IDO. Аминокислотный анализ был проведен на реакционных смесях, в которых сукцинат генерировался IDO из αKG.Единственный пик вновь продуцируемой аминокислоты наблюдался в каждой реакционной смеси с использованием l-лейцина, l-норвалина, l- алло -Ile, (2 S , 3 R , 4 S ) -HIL, l-метионин или l-этионин в качестве субстрата. Только при использовании l-норлейцина в реакции IDO были получены два новых пика аминокислот. Несмотря на то, что в реакционной смеси наблюдали значительное образование сукцината, включая l-цистеин или dl-гомоцистеин, аминокислотный анализ не обнаружил пика новой аминокислоты, даже несмотря на то, что было произведено значительное количество сукцината.Продукты реакции IDO этих аминокислот могут быть не обнаружены с помощью метода анализа, использованного в этом исследовании. Молекулярные массы вновь образованных аминокислот непосредственно анализировали с помощью ЖХ / ESI-MS и сравнивали с таковыми для используемых субстратов (таблица 1). Все продукты из l-лейцина, l-норвалина, l- алло -Иле, l-метионина и l-этионина были на 16 тяжелее их исходных субстратов, что указывает на то, что монооксигенация этих субстратов также катализируется IDO. как гидроксилирование l-Ile.В реакционной смеси, содержащей 1-норлейцин, оба продукта имеют молекулярную массу 148, так что они также являются монооксигенированными продуктами 1-норлейцина. Удивительно, но время удерживания при аминокислотном анализе и молекулярная масса продукта реакции, возникающего из (2 S , 3 R , 4 S ) -HIL, соответствовали таковому для (2 S , 3 R ) -AMKP, который представлял собой С-4 кето-форму l-Ile, ранее обнаруженную в B. thuringiensis 2e2. Этот результат указывает на то, что IDO дегидрировала гидроксильную группу C-4 HIL и образовала кетогруппу C-4 в сочетании с окислительным декарбоксилированием αKG (рис.1А).

Рис. 1.

Окислительные реакции, катализируемые IDO. (A) C-4 гидроксилирование l-Ile в (2 S , 3 R , 4 S ) -HIL и дальнейшее дегидрирование (2 S , 3 R , 4 S ) -HIL в (2 S , 3 R ) -AMKP. (B) C-4-гидроксилирование 1-норвалина, 1-лейцина и 1-норлейцина, а также 1-Ile. (C) C-5-гидроксилирование 1-норлейцина. (D) С-3 гидроксилирование 1- алло -Иле. (E) Сульфоксидирование l-метионина и l-этионина.

Гидроксилирование аминокислот с помощью IDO. Продукты реакции IDO l-норвалина, l-лейцина, l-норлейцина и l- алло -Ile были выделены препаративной жидкостной хроматографией и подвергнуты структурному анализу с использованием ЯМР-спектрометрии (таблица 2 ). Было установлено, что продукт 1-норвалина представляет собой 4-гидрокси-1-норвалин и соответствует ранее опубликованному спектру ЯМР (2) ( S ) -4-гидрокси-1-норвалина (фиг. 1B). Подобно l-Ile, IDO вводит гидроксильную группу на метиленовый углерод в положении 4 l-норвалина, и было подтверждено, что продуктом окисления l-лейцина является 4-гидрокси-1-лейцин (рис.1Б). IDO также гидроксилировал атом углерода метина в положении 4 l-лейцина и генерировал ахиральную группу третичного спирта. Было установлено, что одним из двух продуктов, образованных из 1-норлейцина, является 4-гидрокси-1-норлейцин, образующийся таким же образом, как и при гидроксилировании l-Ile (фиг. 1B). С другой стороны, было обнаружено, что другим продуктом l-норлейцина является 5-гидрокси-1-норлейцин (рис. 1C). Соотношение продуцирования 4-гидрокси-1-норлейцина и 5-гидрокси-1-норлейцина составляло приблизительно 11: 1 при анализе ВЭЖХ.Таким образом, IDO одновременно катализирует гидроксилирование C-4 и C-5 метиленовых атомов углерода 1-норлейцина и генерирует два моногидроксилированных 1-норлейцина, но дигидроксилированный продукт не обнаруживается в реакционной смеси. На основании результатов аминокислотного анализа был также стереоспецифично продуцирован один из двух возможных диастереомеров 4-гидрокси-1-норлейцина или 5-гидрокси-1-норлейцина. Более того, продукт из 1- алло -Иле был определен как 3-гидрокси-1- алло -Иле и соответствовал ранее сообщенному спектру ЯМР ( S ) -3-гидрокси-1- алло -Иль (4).Интересно, что IDO гидроксилировал только углерод метина в положении 3 l- allo -Ile, что отличалось от гидроксилирования C-4 метилена l-Ile в HIL (рис. 1D). Также активность IDO была измерена для ( S ) -4-гидрокси-1-норвалина и 4-гидрокси-1-норлейцина, а также для HIL (таблица 1). Хотя эти гидроксиаминокислоты слабо реагировали с IDO, продукты реакции не были идентифицированы как дегидрированные аминокислоты из-за их малых количеств (таблица 1).

Таблица 2.

Идентификация аминокислотных продуктов в реакциях IDO

Сульфоксидирование аминокислот с помощью IDO. Продукты реакции IDO l-метионина и l-этионина выделяли аналогичным способом с помощью препаративной жидкостной хроматографии и подвергали структурному анализу с использованием ЯМР-спектрометрии (таблица 2 ). Неожиданно 1-метионин и 1-этионин окислились под действием IDO в сульфоксид 1-метионина и сульфоксид 1-этионина, соответственно, вместо гидроксиаминокислот (рис. 1E). На основании результатов аминокислотного анализа один из двух возможных диастереомеров этих сульфоксидов также был получен стереоспецифически.Этот результат указывает на то, что IDO катализирует стереоспецифическое сульфоксидирование некоторых серосодержащих аминокислот в сочетании с окислительным декарбоксилированием αKG.

Аминокислотная конверсия, наблюдаемая в культуре B. thuringiensis 2e2. Биоконверсию аминокислот под действием B. thuringiensis 2e2 проводили так же, как описано ранее (18), за исключением использования l- алло -Иле, l-лейцина, l-норлейцин, l-норвалин, l-метионин и l-этионин вместо l-Ile в бульоне IDO. Все превращения аминокислот, наблюдаемые в реакциях с использованием рекомбинантной IDO, также происходили в B.thuringiensis 2e2 культур. Эти результаты показывают, что нативный IDO в клетках B. thuringiensis 2e2 катализирует превращения аминокислот с субстратной специфичностью, аналогичной специфичности рекомбинантного IDO. Таким образом, эти преобразованные аминокислоты, скорее всего, существуют в естественной среде в виде вторичных метаболитов B. thuringiensis 2e2.

ОБСУЖДЕНИЕ

На основе подробного анализа специфичности субстрата IDO и идентификации продуктов реакции в этом исследовании впервые было продемонстрировано, что αKG-зависимая диоксигеназа катализирует три различных типа реакций: гидроксилирование, сульфоксидирование и дегидрирование, в зависимости от реакции. подложки.

Гидроксилирование, по-видимому, является первичной реакцией, катализируемой IDO, что типично для большинства αKG-зависимых диоксигеназ. IDO катализирует строго стереоселективное гидроксилирование положения C-3, C-4 или C-5 в нескольких l-образных аминокислотах с алифатическими гидрофобными боковыми цепями. Для распознавания субстрата с помощью IDO требовалось более 5 атомов углерода в основной цепи аминокислоты, и вместо метильного углерода гидроксилировался метиленовый или метиновый углерод субстрата; следовательно, l-аланин, l-аминобутират, l-валин и l- tert -лейцин вообще не реагировали с IDO.1-Норлейцин был преобразован в 4-гидроксинорлейцин и 5-гидроксинорлейцин одновременно с помощью IDO. Поскольку только l-норлейцин имел метиленовый углерод C-5 среди аминокислот, протестированных в этом исследовании, остается возможность, что IDO гидроксилатирует C-5 метиленовый углерод и, возможно, C-5 метиновый углерод в других длинных алифатических аминокислотах. Интересно, что метиновый углерод C-3 в l- алло -Иле был гидроксилирован IDO вместо метиленового углерода C-4, в отличие от результатов с l-Ile. Возможно, что стерическое ограничение метильной группы боковой цепи в 1- алло -Иле препятствовало гидроксилированию С-4 с образованием (2 S , 3 S , 4 S ) -4-гидроксиизолейцина.

Это первый отчет, демонстрирующий, что реакции сульфоксидации и дегидрирования катализируются ферментом суперсемейства αKG-зависимых диоксигеназ. Хотя сообщалось, что несколько ферментов, принадлежащих к суперсемейству монооксигеназы цитохрома P450, катализируют гидроксилирование, сульфоксидирование и дегидрирование (20), в этой статье впервые было показано, что αKG-зависимая диоксигеназа также по-разному катализирует эти реакции, в зависимости от субстрата. . Сульфоксидирование двух серосодержащих аминокислот не опосредовано реактивными формами кислорода, образующимися в реакции разобщения IDO, но катализируется ферментативно непосредственно IDO, поскольку стереоселективность сульфоксидирования строго контролируется в реакции.Абсолютные стереоструктуры сульфоксида l-метионина и сульфоксида l-этионина все еще исследуются. Известно, что сульфоксидирование l-метионина катализируется флавинсодержащей монооксигеназой (FMO), которая обнаруживается в микросомах млекопитающих (9). Однако эта реакция может не происходить in vivo , потому что кажущаяся K m FMO по отношению к метионину была выше физиологической концентрации. Кроме того, потребуется подробный кинетический анализ сульфоксидации под действием IDO, чтобы определить, имеет ли эта реакция физиологическое значение для B.thuringiensis 2e2 клеток. С другой стороны, IDO дегидрировал (2 S , 3 R , 4 S ) -HIL в (2 S , 3 R ) -AMKP, но эта активность не имеет физиологического значения, поскольку Удельная активность IDO была очень низкой по отношению к HIL, и это преобразование в значительной степени осуществлялось NAD + -зависимой HIL дегидрогеназой в B. thuringiensis 2e2 (23).

В нашей предыдущей работе, вместе с реакцией сочетания альдолаза-трансаминаза для производства HIL из ацетальдегида, α-кетобутирата и l-глутамата (24, 32), была создана высокоэффективная система биотрансформации, превращающая l-Ile в (2 S , 3 R , 4 S ) -HIL с использованием IDO (31).Генетически модифицированный штамм E. coli, который накапливал αKG и был способен эффективно транспортировать аминокислоту с разветвленной цепью, использовали в качестве штамма-хозяина для ускорения реакции гидроксилирования с помощью гетерологически экспрессируемой IDO. Эту систему можно было бы легко применить для производства других гидроксиаминокислот, производимых IDO, обнаруженных в этом исследовании. Эти гидроксиаминокислоты достаточно ценны для производства в больших масштабах. Например, ( S ) -3-гидрокси-1- алло -Иле представляет собой разновидность β-гидрокси α-аминокислоты, которая является важными веществами из-за их биологической активности и их способности служить промежуточными соединениями для различных соединения, такие как β-лактамы (4).4-Гидрокси-1-лейцин является компонентом фаллоина, который является одним из токсичных бициклических пептидов, продуцируемых грибом Amantia phalloides (36). Флуоресцентно меченый фаллоин является полезным реагентом для окрашивания актиновых нитей для световой микроскопии в клеточной биологии (33). ( S ) -4-Гидрокси-1-норвалин стимулировал только высвобождение инсулина изолированными островками крысы, а также (2 S , 3 R , 4 S ) -HIL (6). Также эта гидроксиаминокислота была выделена из семян Lathyrus odoratus (11), а семена Crotalaria juncea содержат 5-гидрокси-1-норлейцин (28).Интересно, что организмы, которые накапливают большое количество гидроксигидрофобных аминокислот в своих семенах, включая L. odoratus, C. juncea и пажитник, принадлежат к Leguminosae. Хотя до сих пор неизвестно, какую роль эти аминокислоты играют в семенах, ожидается, что они будут иметь полезную функцию, например, некоторую физиологическую активность. Лактоны 4-гидрокси-1-норвалина и 4-гидрокси-1-норлейцина являются аналогами лактонов ацил-гомосерина, которые являются сигнальными молекулами, участвующими в зондировании бактериального кворума.Эти аналоги могут использоваться в качестве контрольных молекул для экспрессии генов в эукариотических клетках (21). Крупномасштабное получение этих полезных гидроксиаминокислот теперь стало возможным благодаря использованию IDO в качестве биокатализатора, а также позволило бы в дальнейшем открыть их полезные свойства.

Гидроксиаминокислоты и сульфоксиды аминокислот, обнаруженные в качестве продуктов реакции IDO, также могут быть встречающимися в природе вторичными метаболитами B. thuringiensis 2e2, а также (2 S , 3 R , 4 S ) — HIL и (2 S , 3 R ) -АМКП.Эти метаболиты могут играть определенную роль, например (2 S , 3 R ) -AMKP (27), в природных сложных биологических сообществах.

БЛАГОДАРНОСТИ

Эта работа была частично поддержана грантом на научные исследования (№ 21780070, выданный Министерством образования, культуры, спорта, науки и технологий Японии) и Проектом развития Технологическая инфраструктура для промышленных биопроцессов в исследованиях и разработках новых промышленных границ науки и технологий (С.S. и J.O.) из Организации по развитию новой энергетики и промышленных технологий (NEDO) Японии.

  • Авторские права © 2011, Американское общество микробиологии. Все права защищены.

L-изолейцин (YMDB00038) — База данных метаболома дрожжей

L-Isoleucine Штамм пептиды, пептиды пептиды Точка плавления
Идентификация
Идентификатор YMDB YMDB00038

Пекарские дрожжи
Описание Изолейцин (сокращенно Ile или I) представляет собой альфа-аминокислоту.L-изомер является одной из 22 протеиногенных аминокислот, то есть строительных блоков белков. Он классифицируется как неполярная аминокислота с разветвленной цепью из-за гидрофобной природы разветвленной боковой алкильной цепи. Вместе с треонином изолейцин является одной из двух распространенных аминокислот, которые имеют хиральную боковую цепь. он синтезируется в несколько этапов, начиная с пировиноградной кислоты и альфа-кетоглутарата. Ферменты, участвующие в этом биосинтезе, включают: ацетолактатсинтазу (также известную как синтаза ацетогидроксикислот), изомероредуктаза ацетогидроксикислот, дегидратаза дигидроксикислот и валинаминотрансфераза.
S. cerevisiae разлагает аминокислоты с разветвленной цепью (валин, лейцин и изолейцин) по пути Эрлиха. Этот путь состоит из 3 этапов: 1) дезаминирование аминокислоты до соответствующей альфа-кетокислоты; 2) декарбоксилирование полученной альфа-кетокислоты до соответствующего альдегида; и 3) восстановление альдегида с образованием соответствующего длинноцепочечного или сложного спирта, известного как сивушный спирт или сивушное масло. Сивушные спирты являются важными вкусовыми и ароматическими соединениями в пищевых продуктах и ​​напитках, подвергнутых дрожжевой ферментации.Каждая из трех стадий разложения аминокислот с разветвленной цепью может катализироваться более чем одним изоферментом; Какой фермент используется, по-видимому, зависит от аминокислоты, источника углерода и стадии роста культуры. Первоначальная стадия трансаминирования при расщеплении изолейцина может быть катализатором трансаминаз аминокислот с разветвленной цепью BAT1 (митохондриальная) или BAT2 (цитозольная). Последующая стадия декарбоксилирования может катализироваться любой из пяти декарбоксилаз (Pdc1p, Pdc5p, Pdc6p, Thi3p и Aro10p), а последняя стадия может катализироваться любой из шести алкогольдегидрогеназ (Adh2p, Adh3p, Adh4p, Adh5p, Adh5p. , и Sfa1p).
Структура

Синонимы
  • (2S, 3S) -2-амино-3-метил-пентаноат
  • (2S, 3S) -2-амино-3-метилпентановая кислота
  • (2S, 3S) -2-амино-3-метилпентаноат
  • (2S, 3S) -2-амино-3-метилпентановая кислота
  • (2S, 3S) -a-амино-b-метил-н-валерат
  • (2S, 3S) -a-амино-b-метил-н-валериановая кислота
  • (2S, 3S) -a-амино-b-метилвалерат
  • (2S, 3S) -a-амино-b-метилвалериановая кислота
  • (2S, 3S) -альф-амино-бета-метилвалерат
  • (2S, 3S) -альф-амино-бета-метилвалериановая кислота
  • (2S, 3S) -альфа-амино-бета-мертил-н-валерат
  • (2S, 3S) -альфа-амино-бета-мертил-н-валериановая кислота
  • (2S, 3S) -альфа-амино-бета-мертилвалерат
  • (2S, 3S) -альфа-амино-бета-мертилвалериановая кислота
  • (2S, 3S) -альфа-амино-бета-метил-н-валерат
  • (2S, 3S) -альфа-амино-бета-метил-н-валериановая кислота
  • (2S, 3S) -альфа-амино-бета-метилвалерат
  • (2S, 3S) -альфа-амино-бета-метилвалериановая кислота
  • (S, S) -изолейцин
  • (S) -изолейцин
  • [S- (R *, R *)] — 2-амино-3-метилпентаноат
  • [S- (R *, R *)] — 2-амино-3-метилпентановая кислота
  • 2-амино-3-метилпентаноат
  • 2-амино-3-метилпентановая кислота
  • 2-амино-3-метилвалерат
  • 2-амино-3-метилвалериановая кислота
  • 2S, 3S-изолейцин
  • a-амино-b-метилвалерат
  • a-амино-b-метилвалериановая кислота
  • Аллоизолейцин
  • альфа-амино-бета-метилвалерат
  • альфа-амино-бета-метилвалериановая кислота
  • эритро-L-изолейцин
  • I
  • Иль
  • изолейцин
  • Изолейцин
  • Изолейцин, L-изомер
  • Изолейцин, L-изомер
  • л — (+) — Изолейцин
  • L-Ile
  • L-Изомер изолейцин
  • α-амино-β-метилвалерат
  • α-амино-β-метилвалериановая кислота
  • 2S-амино-3S-метилпентаноат
  • L-изолейцин
Номер CAS 73-32-5
Вес Среднее значение: 131.1729
Моноизотопный: 131.094628665
Шпонка InChI AGPKZVBTJJNPAG-WHFBIAKZSA-N
InChI InChI = 1S / 2 / C6 -5H, 3,7h3,1-2h4, (H, 8,9) / t4-, 5- / m0 / s1
Название IUPAC (2S, 3S) -2-амино-3-метилпентановая кислота
Традиционное название IUPAC L-изолейцин
Химическая формула C 6 H 13 NO 2
SMILES [H] [OC @ = @] ([H]) (N ([H]) [H]) [C @@] ([H]) (C ([H]) ([H]) [H]) C ([H]) ([H]) C ([H]) ([H]) [H]
Химическая систематика
Описание относится к классу органических соединений, известных как изолейцин и его производные.Изолейцин и производные представляют собой соединения, содержащие изолейцин или его производное, полученные в результате реакции изолейцина по аминогруппе или карбоксигруппе или в результате замены любого водорода глицина гетероатомом.
Королевство Органические соединения
Супер-класс Органические кислоты и производные
Класс Карбоновые кислоты и производные
Подкласс Прямой родитель Изолейцин и производные
Альтернативные родители
Заместители
  • Изолейцин или производные
  • Альфа-аминокислота
  • L-альфа-аминокислота
  • Разветвленная жирная кислота
  • Метил-разветвленная жирная кислота
  • Жирная кислота
  • жирный ацил
  • Аминокислота
  • Кислота монокарбоновая или производные
  • Карбоновая кислота
  • Органический оксид
  • Органопниктогенное соединение
  • Первичный амин
  • Кислородорганическое соединение
  • Азоторганическое соединение
  • Первичный алифатический амин
  • Карбонильная группа
  • Органическое кислородное соединение
  • Амин
  • Органическое соединение азота
  • Производные углеводородов
  • Алифатическое ациклическое соединение
Молекулярный каркас Алифатические ациклические соединения
Внешние дескрипторы
Физические свойства
9033 9033 9033 9033 9033 9033 9033 9034 285.5 ° C
Экспериментальные свойства
Свойство Значение Ссылка
Растворимость в воде 34,4 мг / мл при 25 ° C [YALKOWSKY ] PhysProp
LogP -1,70 [HANSCH, C. ET AL. (1995)] PhysProp
Прогнозируемые свойства
Биологические свойства
Клеточные местоположения
  • внеклеточные
  • митохондрия
  • вакуоль
  • цитоплазма
Органолептические свойства
SMPDB Pathways
KEGG Pathways
Валин, лейцин 9034 9034 9034 9034 9034 9034 9034 903 деградация ec00280
SMPDB Реакции
KEGG Реакции
концентрации
внутриклеточной концентрации
внутриклеточной концентрации Субстрат роста условия Штамм Цитирование
938 ± 19 мкМ Среда YPD аэробная Пекарские дрожжи PMID: 7654310
41 Среда YPG аэробная Пекарские дрожжи PMID: 7654310
235 ± 5 мкМ Среда SD аэробная SGD 341 среда аэробные пекарские дрожжи PMID: 7654310
626 ± 12 мкМ M (меласса) аэробные пекарские дрожжи PMID: 76543 M (меласса) аэробные пекарские дрожжи PMID: 7654310
1173 ± 23 мкм MB (меласса) аэробные пекарские дрожжи 10 10 PMID 7 МАБ (меласса) аэробные Пекарские дрожжи PMID: 7654310
1359 ± 68 мкМ СМИ ЕБ с 0.5 мМ глюкозы аэробные пекарские дрожжи экспериментально
нет данных
700 ± 67 мкМ синтетическая среда с 20 г / л глюкозы аэробные PM PM PM
Подробная информация о преобразовании здесь
Внеклеточные концентрации Недоступно
Spectra
Spectra 0000-de9162d149073d0e2a 0000-742e44c426ac0d6c 0000-dbb33e0f02ac2ca5fedd 0000-de9162d149073d0e2a37 0000-742e44c426c0d6c2a9ac 0000-dbb33e0f02ac2ca5fedd 00000-27891dff695c5db53796 0000-43ec1890f6dbd6aea657 00000-40bc9ef43da5f18be883 GC-MS / MoNA LC-a4 MoNA
GC-MS GC-MS Spectrum — GC-EI-TOF (Pegasus III TOF-MS system, Leco; GC 6890, Agilent Technologies) (2 TMS) splash20-0a4i-0930000000-e78f845bb2a8d4736476 JpectraViewer | MoNA
GC-MS GC-MS Spectrum — GC-EI-TOF (Pegasus III TOF-MS system, Leco; GC 6890, Agilent Technologies) (2 TMS) splash20-0a4i-0
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (система Pegasus III TOF-MS, Leco; GC 6890, Agilent Technologies) (2 TMS) splash20-0a4i-0

0000-599e61f8ccdb6525c7a
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (система Pegasus III TOF-MS, Leco; GC 6890, Agilent Technologies) (без производных) splash20-0a4i-0
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (система Pegasus III TOF-MS, Leco; GC 6890, Agilent Technologies) (2 TMS) splash20-05fr-8
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — EI-B (без производных) splash20-0a4i-0

0000-37690f426455ac41e2c2
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (без производных) splash20-0a4i-0930000000-e78f845bb2a8d4736476 JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (без производных) splash20-0a4i-0
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (без производных) splash20-0a4i-0

0000-599e61f8ccdb6525c7a9
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (без производных) splash20-0a4i-0
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-QQ (без производных) splash20-0udi-23

000-74cca1eb265b8e3d7f43
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (без производных) splash20-05fr-8
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (без производных) splash20-000i-
JSpectraViewer | MoNA
ГХ-МС Спектр ГХ-МС — GC-EI-TOF (без производных) splash20-0a4i-0
JSpectraViewer | MoNA
Прогнозируемый ГХ-МС Прогнозируемый спектр ГХ-МС — ГХ-МС (без производных) — 70 эВ, положительный всплеск 20-00b9-
Красный JSpectraViewer
Прогнозируемый спектр ГХ-МС — ГХ-МС (1 ТМС) — 70 эВ, положительный splash20-000i-

00000-ae8694c0f3e4dcc608f9
JSpectraViewer
ЖХ-МС / МС LC-MS , Положительный (аннотированный) splash20-000i-9300000000-8a23b3e62231eb65f80f JSpectraViewer | MoNA
LC-MS / MS LC-MS / MS Spectrum — Quattro_QQQ 25V, Positive (Annotated) splash20-00ko-

00000-ac7e71578d7e1d0e8ce9

JSpectraViewer | MoNA
LC-MS / MS LC-MS / MS Spectrum — Quattro_QQQ 40V, Positive (Annotated) splash20-052f-

00000-2586d4a089921dd977ed

JSpectraViewer | MoNA
LC-MS / MS LC-MS / MS Spectrum — LC-ESI-ITFT (LTQ Orbitrap XL, Thermo Scientfic), положительный splash20-001i-0

0000-5b11521ff6a631376d2b

JSpectra MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-ITFT (LTQ Orbitrap XL, Thermo Scientfic), положительный splash20-000i-

00000-3c352f229e4067fcd489

JSpectra | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-ITFT (LTQ Orbitrap XL, Thermo Scientfic), положительный splash20-000i-

00000-8a7ef48fc0c1b6f845c2

Jpectra Jpectra | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — ЖХ-ESI-ITFT (LTQ Orbitrap XL, Thermo Scientfic), положительный splash20-0002-0

0000-2e11aa1c7a5defc386db
Jpectra Jpectra | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-ITFT (LTQ Orbitrap XL, Thermo Scientfic), положительный splash20-001i-0

0000-b63ac9cf06eda4c54a81

J MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-ITFT (LTQ Orbitrap XL, Thermo Scientfic), положительный splash20-000i-

00000-e5b0c8c6b09f541d6dbf

ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-ITFT (LTQ Orbitrap XL, Thermo Scientfic), положительный splash20-000i-

00000-d89d16d5c2242e44ec63

Jpectra | MoNA
LC-MS / MS LC-MS / MS Spectrum — LC-ESI-ITFT (LTQ Orbitrap XL, Thermo Scientfic), положительный splash20-000i-

00000-5de583142c7bdb381c8f

Jpectra | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 10 В, отрицательный splash20-001i-0

0000-8c75bde35c4a4073ee65

JSpectra | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 20 В, отрицательный splash20-001i-0

0000-233a9862f616afea2d17

JS MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 30 В, отрицательный splash20-001i-1

0000-375f35065b82b13e6d6e

Jpectra | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 40 В, отрицательный splash20-00dl-

00000-d0d4a9f90fe2aca74483

Jpectra | MoNA
LC-MS / MS LC-MS / MS Spectrum — LC-ESI-QQ (API3000, Applied Biosystems) 50 В, отрицательный splash20-0006-

00000-0018f47571feaf232ff8

JSpectraViewer MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 10 В, положительный splash20-001r-7

0000-278dc67396114be331ba

JSpectraViewer | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 20 В, положительный splash20-000i-

00000-e26c042aa6231eeca071

JSpectra | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 30 В, положительный splash20-014r-

00000-b6c1752fd3fbccb3d1c5

Jpectra | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 40 В, положительный splash20-05mo-

00000-0569c3162621252ed0a8

JSpectraViewer | MoNA
ЖХ-МС / МС Спектр ЖХ-МС / МС — LC-ESI-QQ (API3000, Applied Biosystems) 50 В, положительный splash20-052f-

00000-3d52b5d56d3fab45276e

JSpectra | MoNA
LC-MS / MS LC-MS / MS Spectrum — CE-ESI-TOF (CE-система, подключенная к времяпролетному МС 6210, Agilent), положительный splash 20-001i-0

0000- 720554d58264a9cfdb67

JSpectraViewer | MoNA
Прогнозируемый ЖХ-МС / МС Прогнозируемый спектр ЖХ-МС / МС — 10 В, положительный всплеск 20-0019-9500000000-00268b2694cde281641b JSpectraViewer
Прогнозируемый LC- -МС / МС-спектр — 20 В, положительный всплеск 20-000i-

00000-4014793e17e02

JSpectraViewer
Прогнозируемый ЖХ-МС / МС Прогнозируемый спектр ЖХ-МС / МС — 40 В-

00000-eb9a97a14461e524e76e

JSpectraViewer
MS Масс-спектр (электронная ионизация) splash20-004r-

00000-34d4d4cb7042da231eb1 JSpectra

1D ЯМР 1H ЯМР-спектр Недоступно JSpectraViewer
1D ЯМР 13C ЯМР-спектр JSpectra JSpectra Недоступно JSpectraViewer
2D ЯМР [1H, 1H] 2D ЯМР-спектр Недоступно JSpectraViewer
2D ЯМР [1H, 13C] 2D JSpectraViewer
Ссылки
Ссылки:
  • Martinez-Force, E., Бенитес, Т. (1995). «Влияние различных сред, температуры и скорости роста на внутриклеточные концентрации дрожжевых аминокислот». Biotechnol Prog 11: 386-392.7654310
  • Консорциум UniProt (2011 г.). «Текущие и будущие разработки Universal Protein Resource». Нуклеиновые кислоты Res 39: D214-D219.21051339
  • Herrgard, MJ, Swainston, N., Dobson, P., Dunn, WB, Arga, KY, Arvas, M., Bluthgen, N., Borger, S., Costenoble, R., Heinemann, M., Hucka, М., Ле Новер, Н., Ли, П., Либермейстер, В., Мо, М.Л., Оливейра, А.П., Петранович, Д., Петтифер, С., Симеонидис, Э., Смоллбоун, К., Спасич, И., Вейхарт, Д., Брент , Р., Брумхед, Д.С., Вестерхофф, Х.В., Кирдар, Б., Пенттила, М., Клипп, Э., Палссон, Б.О., Зауэр, У., Оливер, С.Г., Мендес, П., Нильсен, Дж., Келл, ДБ (2008). «Консенсусная реконструкция метаболической сети дрожжей, полученная на основе общественного подхода к системной биологии». Nat Biotechnol 26: 1155-1160.18846089
  • Иден, А., Ван Недервельде, Л., Друккер, М., Бенвенисти, Н., Дебург, А. (2001). «Участие аминотрансфераз аминокислот с разветвленной цепью в производстве сивушных спиртов во время ферментации на дрожжах». Appl Microbiol Biotechnol 55: 296-300.11341309
  • Freist, W., von der Haar, F., Cramer, F. (1981). «Изолейцил-тРНК синтетаза из пекарских дрожжей. Действие аналогов АТФ в пирофосфатном обмене и аминоацилировании, два пути аминоацилирования в зависимости от концентрации пирофосфата». Eur J Biochem 119: 151-164.6281001
  • Ганс, М.А., Хайнцле, Э., Виттманн, К. (2003). «Пулы свободных внутриклеточных аминокислот во время автономных колебаний у Saccharomyces cerevisiae». Биотехнология Биоенг 82: 143-151.12584756
  • Nookaew, I., Jewett, M. C., Meechai, A., Thammarongtham, C., Laoteng, K., Cheevadhanarak, S., Nielsen, J., Bhumiratana, S. (2008). «Модель метаболизма в масштабе генома iIN800 Saccharomyces cerevisiae и ее валидация: каркас для изучения липидного метаболизма». BMC Syst Biol 2:71.18687109
  • Янг, З., Хуанг, Дж., Гэн, Дж., Наир, У., Клионски, Д. Дж. (2006). «Atg22 перерабатывает аминокислоты, чтобы связать деградационные и рециклирующие функции аутофагии». Mol Biol Cell 17: 5094-5104.17021250
  • Цаголофф А., Штанко А. (1995). «Митохондриальные и цитоплазматические изолейцил-, глутамил- и аргинил-тРНК-синтетазы дрожжей кодируются отдельными генами». Eur J Biochem 230: 582-586.7607232
  • Кишпал, Г., Штайнер, Х., Корт, Д. А., Ролински, Б., Лилль, Р.(1996). «Митохондриальные и цитозольные аминокислотные трансаминазы с разветвленной цепью дрожжей, гомологи белка Eca39, регулируемого онкогеном myc». J Biol Chem 271: 24458-24464.8798704
  • Харрис, К. Л., Коланко, К. Дж. (1995). «Комплекс аминоацил-тРНК синтетазы в Saccharomyces cerevisiae». Biochem J 309 (Pt 1): 321-324.7619074
  • Кастрилло, Д.И., Зиф, Л.А., Хойл, округ Колумбия, Чжан, Н., Хейс, А., Гарднер, округ Колумбия, Корнелл, М.Дж., Петти, Дж., Хейкс, Л., Уордлворт, Л., Рэш, Б. , Браун, М., Данн, В.Б., Бродхерст, Д., О’Донохью, К., Хестер, С.С., Данкли, Т.П., Харт, С.Р., Суэйнстон, Н., Ли, П., Гаскелл, С.Дж., Патон, Н.З., Лилли, Канзас , Келл, Д.Б., Оливер, С.Г. (2007). «Контроль роста эукариотической клетки: исследование системной биологии на дрожжах». J Biol 6: 4,17439666
Ссылка на синтез: Marvel, C.S. L-изолейцин. Органический синтез (1941), 21 60-4.
Внешние ссылки:

ido — L-изолейцин-4-гидроксилаза — Bacillus thuringiensis

Этот подраздел Имена и таксономия содержит исчерпывающий список всех названий белка, от широко используемых до устаревших, чтобы можно было однозначно идентифицировать белок.

Подробнее …

Названия белков i

Рекомендуемое название:

L-изолейцин-4-гидроксилаза

Информация, подобранная вручную, основанная на утверждениях в научных статьях, не подтвержденных экспериментально.

Дополнительно …

Ручное утверждение, основанное на мнении в i

  • «Метаболическая инженерия Escherichia coli для производства (2S, 3R, 4S) -4-гидроксиизолейцина».
    Смирнов С.В., Кодера Т., Самсонова Н.Н., Котлярова В.А., Рушкевич Н.Ю., Киверо А.Д., Соколов П.М., Хиби М., Огава Дж., Симидзу С.
    Прил. Microbiol. Biotechnol. 88: 719-726 (2010) [PubMed] [Europe PMC] [Abstract]

    Цитируется по: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [ГЕНОМНАЯ ДНК], ФУНКЦИЯ, КАТАЛИТИЧЕСКАЯ АКТИВНОСТЬ, БИОТЕХНОЛОГИЯ.

(EC: 1.14.11.45

Ручное утверждение, основанное на эксперименте в и

  • «Метаболическая инженерия Escherichia coli для производства (2S, 3R, 4S) -4-гидроксиизолейцина».
    Смирнов С.В., Кодера Т., Самсонова Н.Н., Котлярова В.А., Рушкевич Н.Ю., Киверо А.Д., Соколов П.М., Хиби М., Огава Дж., Симидзу С.
    Appl. Microbiol. Biotechnol. 88: 719-726 (2010) [PubMed] [Europe PMC ] [Abstract]

    Цитируется по: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [ГЕНОМНАЯ ДНК], ФУНКЦИЯ, КАТАЛИТИЧЕСКАЯ АКТИВНОСТЬ, БИОТЕХНОЛОГИЯ.

  • «Новый фермент гидроксилирования l-изолейцина, l-изолейциндиоксигеназа из Bacillus thuringiensis, производит (2S, 3R, 4S) -4-гидроксиизолейцин».
    Кодера Т., Смирнов С.В., Самсонова Н.Н., Козлов Ю.И., Кояма Р., Хиби М., Огава Дж., Йокозеки К., Симидзу С.
    Biochem. Биофиз. Res. Commun. 390: 506-510 (2009) [PubMed] [Europe PMC] [Реферат]

    Цитируется по: ФУНКЦИЯ, КАТАЛИТИЧЕСКАЯ АКТИВНОСТЬ, КОФАКТОР, БИОТЕХНОЛОГИЯ.

  • Указано для: НАЗНАЧЕНИЕ, КАТАЛИТИЧЕСКАЯ АКТИВНОСТЬ.

)

Альтернативное название (я):

L-изолейциндиоксигеназа

Ручное утверждение, основанное на мнении в i

  • «Новый фермент гидроксилирования l-изолейцина, l-изолейциндиоксигеназа из Bacillus thuringiensis, производит (2S , 3R, 4S) -4-гидроксиизолейцин ».
    Кодера Т., Смирнов С.В., Самсонова Н.Н., Козлов Ю.И., Кояма Р., Хиби М., Огава Дж., Йокозеки К., Симидзу С.
    Biochem. Биофиз. Res. Commun. 390: 506-510 (2009) [PubMed] [Europe PMC] [Реферат]

    Цитируется по: ФУНКЦИЯ, КАТАЛИТИЧЕСКАЯ АКТИВНОСТЬ, КОФАКТОР, БИОТЕХНОЛОГИЯ.

Краткое название:

IDO

Ручное утверждение, основанное на мнении в i

  • «Новый фермент гидроксилирования l-изолейцина, l-изолейциндиоксигеназа из Bacillus thuringiensis, производит (2S, 3R, 4S) -4 -гидроксиизолейцин «.
    Кодера Т., Смирнов С.В., Самсонова Н.Н., Козлов Ю.И., Кояма Р., Хиби М., Огава Дж., Йокозеки К., Симидзу С.
    Biochem. Биофиз. Res. Commun. 390: 506-510 (2009) [PubMed] [Europe PMC] [Реферат]

    Цитируется по: ФУНКЦИЯ, КАТАЛИТИЧЕСКАЯ АКТИВНОСТЬ, КОФАКТОР, БИОТЕХНОЛОГИЯ.

В этом подразделе раздела Имена и таксономия указаны названия гена. (ы), которые кодируют последовательность (и) белка, описанную в записи. Существует четыре различных токена: «Имя», «Синонимы», «Упорядоченные имена локусов» и «Имена ORF».

Подробнее …

Имена генов i
Имя: ido

Утверждение вручную, основанное на мнении в i

  • «Метаболическая инженерия Escherichia coli для производства (2S, 3R, 4S) -4-гидроксиизолейцина. .»
    Смирнов С.В., Кодера Т., Самсонова Н.Н., Котлярова В.А., Рушкевич Н.Ю., Киверо А.Д., Соколов П.М., Хиби М., Огава Дж., Симидзу С.
    Appl. Microbiol. Biotechnol. 88: 719-726 (2010 ) [PubMed] [Europe PMC] [Реферат]

    Цитируется по: ПОСЛЕДОВАТЕЛЬНОСТЬ НУКЛЕОТИДОВ [ГЕНОМИЧЕСКАЯ ДНК], ФУНКЦИЯ, КАТАЛИТИЧЕСКАЯ АКТИВНОСТЬ, БИОТЕХНОЛОГИЯ

Стратегия повышения эффективности производства L-isoleucine96000 glutamicum 9000 в коринебактериях

Abatemarco J, Hill A, Alper HS (2013) Расширение набора инструментов метаболической инженерии с направленной эволюцией.Biotechnol J 8: 1397–1410

Статья CAS PubMed Google ученый

  • Becker J, Gießelmann G, Hoffmann SL, Wittmann C (2018) Corynebacterium glutamicum для устойчивого биопроизводства: от метаболической физиологии до системной метаболической инженерии. Adv Biochem Eng Biotechnol 162: 217–263

    PubMed Google ученый

  • Chae TU, Choi SY, Kim JW, Ko YS, Lee SY (2017) Последние достижения в области инструментов и стратегий системной метаболической инженерии.Curr Opin Biotechnol 47: 67–82

    Статья CAS PubMed Google ученый

  • Chen Z, Meyer W, Rappert S, Sun J, Zeng AP (2011) Коэволюционный анализ позволил рационально отменить ингибирование аллостерических ферментов в Corynebacterium glutamicum для производства лизина. Appl Environ Microbiol 77: 4352–4360

    Статья CAS PubMed PubMed Central Google ученый

  • Chen C, Li Y, Hu J, Dong X, Wang X (2015) Метаболическая инженерия Corynebacterium glutamicum ATCC13869 для производства l-валина.Metab Eng 29: 66–75

    Статья CAS PubMed Google ученый

  • Colón GE, Jetten MS, Nguyen TT, Gubler ME, Follettie MT, Sinskey AJ, Stephanopoulos G (1995) Влияние индуцируемой экспрессии thrB на продукцию аминокислот в Corynebacterium lactofermentum ATCC 21799. Appl Environ Microbiol 61:74 –78

    PubMed PubMed Central Google ученый

  • Dong X, Quinn PJ, Wang X (2011) Метаболическая инженерия Escherichia coli и Corynebacterium glutamicum для производства L-треонина.Biotechnol Adv 29: 11–23

    Статья CAS PubMed Google ученый

  • Dong X, Quinn PJ, Wang X (2012) Микробная метаболическая инженерия для производства L-треонина. Subcell Biochem 64: 283–302

    Статья CAS PubMed Google ученый

  • Dong X, Zhao Y, Hu J, Li Y, Wang X (2016a) Ослабление продукции l-лизина за счет делеции ddh и lysE и их влияние на продукцию l-треонина и l-изолейцина в Corynebacterium glutamicum .Enzym Microb Technol 93-94: 70–78

    Статья CAS Google ученый

  • Dong X, Zhao Y, Zhao J, Wang X (2016b) Характеристика аспартаткиназы и гомосериндегидрогеназы из Corynebacterium glutamicum IWJ001 и систематическое исследование биосинтеза L-изолейцина. J Ind Microbiol Biotechnol 43: 873–885

    Статья CAS PubMed Google ученый

  • Elisáková V, Pátek M, Holátko J, Nesvera J, Leyval D, Goergen JL, Delaunay S (2005) Устойчивая к обратной связи синтаза ацетогидроксикислот увеличивает выработку валина в Corynebacterium glutamicum .Appl Environ Microbiol 71: 207–213

    Статья CAS PubMed PubMed Central Google ученый

  • Follettie MT, Shin HK, Sinskey AJ (1988) Организация и регуляция локусов Corynebacterium glutamicum hom-thrB и thrC. Mol Microbiol 2: 53–62

    Статья CAS PubMed Google ученый

  • Goldbeck O, Seibold GM (2018) Конструирование pOGOduet — индуцибельного бицистронного вектора для синтеза рекомбинантных белков в Corynebacterium glutamicum .Плазмида 95: 11–15

    Статья CAS PubMed Google ученый

  • Guillouet S, Rodal AA, An G, Lessard PA, Sinskey AJ (1999) Экспрессия катаболической треониндегидратазы Escherichia coli в Corynebacterium glutamicum и ее влияние на продукцию изолейцина. Appl Environ Microbiol 65 (7): 3100–3107

    CAS PubMed PubMed Central Google ученый

  • Guillouet S, Rodal AA, An GH, Gorret N, Lessard PA, Sinskey AJ (2001) Метаболическое перенаправление потока углерода в сторону изолейцина путем экспрессии катаболической треониндегидратазы в сверхпродуцирующей треонин Corynebacterium glutamicum .Appl Microbiol Biotechnol 57 (5–6): 667–673

    Статья CAS PubMed Google ученый

  • Guo Y, Han M, Xu J, Zhang W (2015a) Анализ вариантов синтазы ацетогидроксикислот из штаммов, продуцирующих аминокислоты с разветвленной цепью, и их влияние на синтез аминокислот с разветвленной цепью в Corynebacterium glutamicum . Protein Expr Purif 109: 106–112

    Статья CAS PubMed Google ученый

  • Guo Y, Xu J, Han M, Zhang W (2015b) Создание мутантной треониндегидратазы и ее влияние на синтез изолейцина в Corynebacterium glutamicum .World J Microbiol Biotechnol 31: 1369–1377

    Статья CAS PubMed Google ученый

  • Hashiguchi K, Kojima H, Sato K, Sano K (1997) Влияние мутантного гена Escherichia coli ilvA, кодирующего устойчивую к обратной связи треониндезаминазу, на продукцию L-изолейцина Brevibacterium flavum . Biosci Biotechnol Biochem 61: 105–108

    Статья CAS PubMed Google ученый

  • Holátko J, Elisáková V, Prouza M, Sobotka M, Nesvera J, Pátek M (2009) Метаболическая инженерия пути биосинтеза L-валина в Corynebacterium glutamicum с использованием модуляции активности промотора.J Biotechnol 139 (3): 203–210

    Статья CAS PubMed Google ученый

  • Hu J, Tan Y, Li Y, Hu X, Xu D, Wang X (2013) Создание и применение эффективной системы множественных делеций генов в Corynebacterium glutamicum . Плазмида 70: ​​303–313

    Артикул CAS PubMed Google ученый

  • Hu J, Li Y, Zhang H, Tan Y, Wang X (2014) Создание новой системы экспрессии для использования в Corynebacterium glutamicum .Плазмида 75: 18–26

    Статья CAS PubMed Google ученый

  • Kalinowski J, Cremer J, Bachmann B, Eggeling L, Sahm H, Pühler A (1991) Генетический и биохимический анализ аспартокиназы из Corynebacterium glutamicum . Mol Microbiol 5: 1197–1204

    Статья CAS PubMed Google ученый

  • Кан М.К., Ли Дж., Умм И, Ли Т.С., Ботт М., Парк С.Дж., Ву Х.М. (2014) Платформа синтетической биологии векторов CoryneBrick для экспрессии генов в Corynebacterium glutamicum и ее применение для использования ксилозы.Appl Microbiol Biotechnol 98: 5991–6002

    Статья CAS PubMed Google ученый

  • Keilhauer C, Eggeling L, Sahm H (1993) Синтез изолейцина в Corynebacterium glutamicum : молекулярный анализ оперона ilvB-ilvN-ilvC. J Bacteriol 175: 5595–5603

    Статья CAS PubMed PubMed Central Google ученый

  • Kelle R, Hermann T, Weuster-Botz D, Eggeling L, Krämer R, Wandrey C (1996) Контролируемое глюкозой производство L-изолейцина с подпиткой с использованием рекомбинантных штаммов Corynebacterium glutamicum .J Biotechnol 50: 123–136

  • Kennerknecht N, Sahm H, Yen MR, Pátek M, Saier MH Jr, Eggeling L (2002) Экспорт L-изолейцина из Corynebacterium glutamicum : мембрана с двумя генами нового семейства транслокаторов. J Bacteriol 184: 3947–3956

    Статья CAS PubMed PubMed Central Google ученый

  • Кортманн М., Кул В., Клаффл С., Ботт М. (2015) Хромосомно-кодируемая система экспрессии генов, зависимых от РНК-полимеразы Т7, для Corynebacterium glutamicum : построение и сравнительная оценка на уровне одной клетки.Microb Biotechnol 8: 253–265

    Статья CAS Google ученый

  • Krömer JO, Heinzle E, Schröder H, Wittmann C (2006) Накопление гомолантионина и активация нового пути биосинтеза изолейцина в штаммах с делецией Corynebacterium glutamicum McbR. J Bacteriol 188 (2): 609–618

    Статья CAS PubMed PubMed Central Google ученый

  • Lange C, Mustafi N, Frunzke J, Kennerknecht N, Wessel M, Bott M, Wendisch VF (2012) Lrp Corynebacterium glutamicum контролирует экспрессию оперона brnFE, кодирующего систему экспорта l-метионина и разветвленного метионина. цепные аминокислоты.J Biotechnol 158: 231–241

    Статья CAS PubMed Google ученый

  • Lausberg F, Chattopadhyay AR, Heyer A, Eggeling L, Freudl R (2012) Вектор индуцируемой тетрациклином экспрессии для Corynebacterium glutamicum , обеспечивающий жестко регулируемую экспрессию генов. Плазмида 68: 142–147

    Статья CAS PubMed Google ученый

  • Lee J (2014) Разработка и характеристика векторов экспрессии для Corynebacterium glutamicum .J Microbiol Biotechnol 24: 70–79

    Статья CAS PubMed Google ученый

  • Li Y, Wei H, Wang T, Xu Q, Zhang C, Fan X, Ma Q, Chen N, Xie X (2017) Текущее состояние метаболической инженерии для производства аминокислот и производных семейства l-аспартата . Биоресур Технол 245: 1588–1602

    Артикул CAS PubMed Google ученый

  • Лю Дж, Ван И, Лу И, Чжэн П., Сун Дж, Ма И (2017) Разработка инструментария редактирования генома CRISPR / Cas9 для Corynebacterium glutamicum .Microb Cell Factories 16: 205

    Статья CAS Google ученый

  • Ma W, Wang J, Li Y, Hu X, Shi F, Wang X (2016) Усиление пентозофосфатного пути в Corynebacterium glutamicum для улучшения продукции L-изолейцина. Biotechnol Appl Biochem 63: 877–885

    Статья CAS PubMed Google ученый

  • Ma W, Wang J, Li Y, Yin L, Wang X (2018) Поли (3-гидроксибутират-со-3-гидроксивалерат), продуцируемый совместно с L-изолейцином в Corynebacterium glutamicum WM001.Фабрики микробных клеток 17:93

    Статья CAS Google ученый

  • Mateos LM, Pisabarro A, Pátek M, Malumbres M, Guerrero C, Eikmanns BJ, Sahm H, Martín JF (1994) Транскрипционный анализ и регуляторные сигналы кластера hom-thrB Brevibacterium lactofermentum . J Bacteriol 176: 7362–7371

    Статья CAS PubMed PubMed Central Google ученый

  • McHardy AC, Tauch A, Ruckert C, Pühler A, Kalinowski J (2003) Геномный анализ генов биосинтетических аминотрансфераз Corynebacterium glutamicum .J Biotechnol 104: 229–240

    Статья CAS PubMed Google ученый

  • Mei J, Xu N, Ye C, Liu L, Wu J (2016) Реконструкция и анализ метаболической сети в масштабе генома Corynebacterium glutamicum S9114. Gene 575: 615–622

    Статья CAS PubMed Google ученый

  • Miyajima R, Shiio I (1970) Регулирование биосинтеза аминокислот семейства аспартатов в Brevibacterium flavum .III Свойства гомосериндегидрогеназы. J Biochem 68: 311–319

    Статья CAS PubMed Google ученый

  • Möckel B, Eggeling L, Sahm H (1994) Треониндегидратазы Corynebacterium glutamicum с измененным аллостерическим контролем: их генерация и биохимический и структурный анализ. Mol Microbiol 13: 833–842

  • Morbach S, Sahm H, Eggeling L (1995) Использование устойчивых к обратной связи треониндегидратаз Corynebacterium glutamicum для увеличения потока углерода к L-изолейцину.Appl Environ Microbiol 61: 4315–4320

  • Morbach S, Kelle R, Winkels S, Sahm H, Eggeling L (1996a) Разработка контрольных точек гомосериндегидрогеназы и треониндегидратазы для анализа потока к L-изолейцину в Corynebacterium glutamicum . Appl Microbiol Biotechnol 45: 612–620

    Статья CAS Google ученый

  • Morbach S, Sahm H, Eggeling L (1996b) Производство L-изолейцина с использованием Corynebacterium glutamicum : дальнейшее увеличение потока и ограничение экспорта.Appl Environ Microbiol 62: 4345–4351

    CAS PubMed PubMed Central Google ученый

  • Morbach S, Junger C, Sahm H, Eggeling L (2000) Контроль ослабления ilvBNC в Corynebacterium glutamicum : свидетельство образования лидерного пептида без присутствия сайта связывания рибосомы. J Biosci Bioeng 90: 501–507

    Статья CAS PubMed Google ученый

  • Mustafi N, Grünberger A, Kohlheyer D, Bott M, Frunzke J (2012) Разработка и применение одноклеточного биосенсора для обнаружения L-метионина и аминокислот с разветвленной цепью.Metab Eng 14 (4): 449–457

    Статья CAS PubMed Google ученый

  • Нешвера Дж., Патек М. (2011) Инструменты для генетических манипуляций с Corynebacterium glutamicum и их применения. Appl Microbiol Biotechnol 90: 1641–1654

    Статья CAS PubMed Google ученый

  • Nie C, He T, Zhang W, Zhang G, Ma X (2018) Аминокислоты с разветвленной цепью: за пределами пищевого метаболизма.Int J Mol Sci, 19 (4): E954

  • Okibe N, Suzuki N, Inui M, Yukawa H (2011) Эффективная безмаркерная замена гена в Corynebacterium glutamicum с использованием новой термочувствительной плазмиды. J Microbiol Methods 85: 155–163

    Статья CAS PubMed Google ученый

  • Park JH, Lee SY (2010a) Ферментативное производство аминокислот с разветвленной цепью: акцент на метаболической инженерии. Appl Microbiol Biotechnol 85: 491–506

    Статья CAS PubMed Google ученый

  • Park JH, Lee SY (2010b) Метаболические пути и ферментативное производство аминокислот семейства L-аспартата.Biotechnol J 5: 560–577

    Статья CAS PubMed Google ученый

  • Peng F, Wang X, Sun Y, Dong G, Yang Y, Liu X, Bai Z (2017) Эффективное редактирование генов в Corynebacterium glutamicum с использованием системы CRISPR / Cas9. Фабрики микробных клеток 16 (1): 201

    Статья CAS Google ученый

  • Petit C, Kim Y, Lee SK, Brown J, Larsen E, Ronning DR, Suh JW, Kang CM (2018) Снижение ингибирования обратной связи в гомосеринкиназе (ThrB) Corynebacterium glutamicum усиливает биосинтез l-треска .ACS Omega 3: 1178–1186

    Артикул CAS PubMed PubMed Central Google ученый

  • Pfeifer E, Gätgens C, Polen T, Frunzke J (2017) Адаптивная лабораторная эволюция Corynebacterium glutamicum в сторону более высоких темпов роста на среде с минимальным содержанием глюкозы. Sci Rep 7: 16780

    Статья CAS PubMed PubMed Central Google ученый

  • Plassmeier JK, Busche T, Molck S, Persicke M, Pühler A, Rückert C, Kalinowski J (2013) Система экспрессии, индуцируемая пропионатом, основанная на промоторе Corynebacterium glutamicum prpD2 и его применении для активатора PrpR перенаправление путей биосинтеза аминокислот.J Biotechnol 163: 225–232

    Статья CAS PubMed Google ученый

  • Reed KB, Alper HS (2017) Расширение за пределы канонического метаболизма: взаимодействие альтернативных элементов, синтетической биологии и метаболической инженерии. Synth Syst Biotechnol 3: 20–33

    Статья PubMed PubMed Central Google ученый

  • Reinscheid DJ, Eikmanns BJ, Sahm H (1991) Анализ гена Corynebacterium glutamicum hom , кодирующего устойчивую к обратной связи гомосериндегидрогеназу.J Bacteriol 173: 3228–3230

    Статья CAS PubMed PubMed Central Google ученый

  • Shen J, Chen J, Jensen PR, Solem C (2017) Новый генетический инструмент для оптимизации метаболизма Corynebacterium glutamicum : эффективная и повторяющаяся хромосомная интеграция синтетических библиотек экспрессии, управляемых промоторами. Appl Microbiol Biotechnol 101: 4737–4746

    Статья CAS PubMed Google ученый

  • Shi F, Huan X, Wang X, Ning J (2012) Сверхэкспрессия киназ NAD улучшает биосинтез L-изолейцина у Corynebacterium glutamicum ssp.lactofermentum . Enzym Microb Technol 51 (2): 73–80

    Статья CAS Google ученый

  • Shi F, Li K, Huan X, Wang X (2013) Экспрессия NAD (H) киназы и глюкозо-6-фосфатдегидрогеназы улучшает снабжение NADPH и биосинтез L-изолейцина в Corynebacterium glutamicum ssp. lactofermentum . Appl Biochem Biotechnol 171: 504–521

    Статья CAS PubMed Google ученый

  • Shi F, Li K, Li Y (2015a) Сравнительный протеомный анализ глобального эффекта сверхэкспрессии POS5 и zwf-ppnK в L-изолейцине, продуцирующем Corynebacterium glutamicum ssp.lactofermentum . Biotechnol Lett 37: 1063–1071

    Статья CAS PubMed Google ученый

  • Shi F, Niu T, Fang H (2015b) Производство 4-гидроксиизолейцина рекомбинантной Corynebacterium glutamicum ssp. lactofermentum при оптимальном ограничении кукурузного настоя. Appl Microbiol Biotechnol 99: 3851–3863

    Статья CAS PubMed Google ученый

  • Shi F, Fang H, Niu T, Lu Z (2016) Сверхэкспрессия ppc и lysC для улучшения продукции 4-гидроксиизолейцина и его предшественника l-изолейцина в рекомбинантной Corynebacterium glutamicum ssp.lactofermentum . Enzym Microb Technol 87-88: 79–85

    Статья CAS Google ученый

  • Shi F, Zhang M, Li Y, Fang H (2018) Достаточное поступление NADPH и делеция pknG улучшают продукцию 4-гидроксиизолейцина в рекомбинантной Corynebacterium glutamicum . Enzym Microb Technol 115: 1–8

    Статья CAS Google ученый

  • Стефанопулос Г. Н., Уаллино Дж. Дж. (1991) Жесткость сети и метаболическая инженерия в производстве метаболитов.Science 252: 1675–1681

    Статья CAS PubMed Google ученый

  • Sun JK, Wu XJ, Shi JM, Xu QY, Xie XX, Chen N (2012) Влияние pH на процесс ферментации Escherichia coli L-изолейцина. Food Ferment Ind 38: 12–16

    CAS Google ученый

  • Tan Y, Xu D, Li Y, Wang X (2012) Создание новой системы на основе sacB для безмаркерной делеции гена в C orynebacterium glutamicum .Плазмида 67: 44–52

    Статья CAS PubMed Google ученый

  • Tauch A, Hermann T, Burkovski A, Krämer R, Pühler A, Kalinowski J (1998) Поглощение изолейцина в Corynebacterium glutamicum ATCC 13032 направляется продуктом гена brnQ . Arch Microbiol 169: 303–312

    Статья CAS PubMed Google ученый

  • Vogt M, Haas S, Klaffl S, Polen T, Eggeling L, van Ooyen J, Bott M (2014) Формирование продукта на пределе: метаболическая инженерия Corynebacterium glutamicum для перепроизводства L-лейцина.Metab Eng 22: 40–52

    Статья CAS PubMed Google ученый

  • Vogt M, Krumbach K, Bang WG, van Ooyen J, Noack S, Klein B, Bott M, Eggeling L (2015) Конкурс на прекурсоры: направление синтеза L-изолейцина в Corynebacterium glutamicum без образования побочных продуктов. Appl Microbiol Biotechnol 99: 791–800

  • Wang J, Wen B, Wang J, Xu Q, Zhang C, Chen N, Xie X (2013) Повышение продукции (L) -изолейцина за счет сверхэкспрессии thrABC в сочетании с делецией alaT в Corynebacterium glutamicum .Appl Biochem Biotechnol 171: 20–30

    Статья CAS PubMed Google ученый

  • Ван X, Куинн П.Дж., Ян А. (2015a) Kdo2 -липид A: структурное разнообразие и влияние на иммунофармакологию. Biol Rev Camb Philos Soc 90: 408–427

    Статья PubMed Google ученый

  • Wang J, Wen B, Xu Q, Xie X, Chen N (2015b) Оптимизация стратегии кормления источником углерода и глюкозы для улучшения продукции L-изолейцина Escherichia coli .Biotechnol Biotechnol Equip 29: 374–380

    Статья CAS PubMed PubMed Central Google ученый

  • Wang X, Zhang H, Quinn PJ (2018) Производство L-валина из метаболически модифицированной Corynebacterium glutamicum . Appl Microbiol Biotechnol 102: 4319–4330

    Статья CAS PubMed Google ученый

  • Wendisch VF (2014) Микробное производство аминокислот и производных химических веществ: подходы синтетической биологии к развитию штаммов.Curr Opin Biotechnol 30: 51–58

    Статья CAS PubMed Google ученый

  • Woo HM, Park JB (2014) Недавний прогресс в разработке платформ синтетической биологии и метаболической инженерии Corynebacterium glutamicum . J Biotechnol 180: 43–51

    Статья CAS PubMed Google ученый

  • Xie X, Xu L, Shi J, Xu Q, Chen N (2012) Влияние транспортных белков на продукцию L-изолейцина штаммом, продуцирующим L-изолейцин Corynebacterium glutamicum YILW.J Ind Microbiol Biotechnol 39 (10): 1549–1556

    Статья CAS PubMed Google ученый

  • Xu D, Tan Y, Huan X, Hu X, Wang X (2010a) Создание нового челночного вектора для использования в Brevibacterium flavum , промышленном производителе аминокислот. J Microbiol Methods 80: 86–92

    Статья CAS PubMed Google ученый

  • Xu D, Tan Y, Shi F, Wang X (2010b) Улучшенный челночный вектор, созданный для исследований метаболической инженерии в Corynebacterium glutamicum .Плазмида 64: 85–91

    Статья CAS PubMed Google ученый

  • Xu D, Tan Y, Li Y, Wang X (2011) Создание нового вектора промотор-зонд и его применение для скрининга сильного промотора для метаболической инженерии Brevibacterium flavum . World J Microbiol Biotechnol 27: 961–968

    Статья CAS Google ученый

  • Ямамото К., Цучисака А., Юкава Х. (2017) Аминокислоты с разветвленной цепью.Adv Biochem Eng Biotechnol 159: 103–128

    CAS PubMed Google ученый

  • Ян Дж., Ян С. (2017) Сравнительный анализ геномов Corynebacterium glutamicum : новая перспектива промышленного производства аминокислот. BMC Genomics 18: 940

    Статья CAS PubMed PubMed Central Google ученый

  • Yin L, Hu X, Xu D, Ning J, Chen J, Wang X (2012) Совместная экспрессия устойчивой к обратной связи треониндегидратазы и синтазы ацетогидроксикислот увеличивает продукцию L-изолейцина в Corynebacterium glutamicum .Metab Eng 14 (5): 542–550

    Статья CAS PubMed Google ученый

  • Yin L, Shi F, Hu X, Chen C, Wang X (2013) Увеличение продукции l-изолейцина в Corynebacterium glutamicum за счет сверхэкспрессии глобального регулятора Lrp и двухкомпонентной экспортной системы BrnFE. J Appl Microbiol 114: 1369–1377

    Статья CAS PubMed Google ученый

  • Yin L, Hu X, Wang X (2014a) Протеомный анализ продукции L-изолейцина Corynebacterium glutamicum .J Pure Appl Microbiol 8: 899–908

    CAS Google ученый

  • Yin L, Zhao J, Chen C, Hu X, Wang X (2014b) Увеличение потока углерода и поставки НАДФН для увеличения производства L-изолейцина в Corynebacterium glutamicum . Biotechnol Bioprocess Eng 19: 132–142

    Статья CAS Google ученый

  • Йошида А., Томита Т., Курихара Т., Фушинобу С., Кузуяма Т., Нишияма М. (2007) Структурное понимание согласованного ингибирования аспартаткиназы альфа 2 бета 2 типа из Corynebacterium glutamicum .J Mol Biol 368: 521–536

    Статья CAS PubMed Google ученый

  • Йошида А., Томита Т., Кузуяма Т., Нишияма М. (2010) Механизм согласованного ингибирования гетероолигомерной аспартаткиназы альфа2бета2-типа из Corynebacterium glutamicum . J Biol Chem 285: 27477–27486

    Статья CAS PubMed PubMed Central Google ученый

  • Yu X, Li Y, Wang X (2013) Молекулярная эволюция треониндегидратазы в бактериях.PLoS One 8 (12): e80750

    Артикул CAS PubMed PubMed Central Google ученый

  • Yu X, Li Y, Wang X (2014) Роль ACT-подобного субдомена в бактериальных треониндегидратазах. PLoS One 9 (1): e87550

    Артикул CAS PubMed PubMed Central Google ученый

  • Zhang Y, Shang X, Lai S, Zhang G, Liang Y, Wen T (2012) Разработка и применение системы экспрессии, индуцируемой арабинозой, путем облегчения поглощения индуктора в Corynebacterium glutamicum .Appl Environ Microbiol 78: 5831–5838

    Статья CAS PubMed PubMed Central Google ученый

  • Zhang L, Jia H, Xu D (2015) Конструирование нового вектора экспрессии, зависимого от двойной аргининовой транслокации (Tat), для секреторной продукции гетерологичных белков в Corynebacterium glutamicum . Плазмида 82: 50–55

    Артикул CAS PubMed Google ученый

  • Zhang H, Li Y, Wang C, Wang X (2018) Понимание высокой продукции L-валина в Corynebacterium glutamicum VWB-1 с использованием транскриптомики и протеомики.Sci Rep 8: 3632

    Статья CAS PubMed PubMed Central Google ученый

  • Zhao J, Hu X, Li Y, Wang X (2015) Сверхэкспрессия фактора удлинения рибосом G и фактора рециклинга увеличивает производство L-изолейцина в Corynebacterium glutamicum . Appl Microbiol Biotechnol 99: 4795–4805

    Статья CAS PubMed Google ученый

  • Zheng B, Ma X, Wang N, Ding T, Guo L, Zhang X, Yang Y, Li C, Huo YX (2018) Использование редких кодоно-богатых маркеров для скрининга избыточных продуцентов аминокислот.Nat Commun 9: 3616

    Статья CAS PubMed PubMed Central Google ученый

  • «Влияние L-лейцина и L-изолейцина на гликемический ответ» Дэниела Э. Ньюмайра, Эрика Риваса и др.

    Аннотация

    Предпосылки Было показано, что одновременный прием аминокислот с напитком из глюкозы притупляет повышенный постпрандиальный ответ на глюкозу.Хотя это не совсем ясно, некоторые предполагают, что аминокислоты будут способствовать инсулиновому ответу, вызванному инкретином, который улучшает чувствительность к глюкозе. Таким образом, цель данного исследования — изучить «праймирующий» эффект предварительно проглоченных аминокислот на гликемический контроль у здоровых неактивных взрослых. Мы представляем здесь некоторые предварительные данные от 7 взрослых. Гипотеза Мы предполагаем, что предварительно проглоченные аминокислоты будут ослаблять постпрандиальный подъем глюкозы во время теста на толерантность к глюкозе 75 г. Методы Чтобы проверить это, семь здоровых взрослых людей (женщины: n = 4, мужчины: n = 3, возраст 27.17 ± 4,7 г. Рост 165,84 ± 9,53 см; Масса 82,47 ± 14,63 кг; ИМТ 30,14 ± 7,54 кг / м2; Безжировая масса тела (НМТ) 56,83 ± 20,56 кг; Уровень глюкозы в крови натощак (FBG) 87,43 ± 5,29 мг / дл) прошел четыре рандомизированных слепых исследования. Четыре испытания требовали от участников приема либо лейцина (LEU), либо L-изолейцина (ISO), равной комбинации вместе LEU / ISO и, наконец, контроля. Каждое лечение принималось за 30 минут до 2-часового перорального теста на толерантность к глюкозе с дозировкой 75 г. Аминокислотный напиток (200 мл) был стандартизирован участником LBM (0.3 г / кг), в то время как контроль состоял из инертной стевии и не аминокислотных ингредиентов, обнаруженных в равных количествах, как и другие лечебные смеси (3,54 г). Образцы венозной крови были взяты в начале, а также через 10, 30, 40, 60, 90, 120 и 150 минут после лечения и приема 75 г глюкозы. Поскольку сбор данных продолжается, исследователи все еще не осведомлены о составе аминокислотных напитков, и поэтому результаты представлены как: красный A, зеленый B, желтый C и контроль (белый D). Глюкозу в плазме (GLU) анализировали с использованием анализатора YSI 2900 (Yellow Springs Instruments), при этом определяли концентрации инсулина (INS), глюкагона (GCG), глюкозозависимого инсулинотропного пептида (GIP) и глюкагоноподобного пептида-1 (GLP-1). количественно оценивается с помощью технологии на основе флуоресцентных шариков (MAGPIX, технология Luminex xMAP).Для оценки данных по глюкозе использовали двусторонний анализатор RMANOVA (программное обеспечение Graphpad). Результаты. Предварительный прием аминокислоты не оказал существенного лечебного эффекта на GLU по сравнению с контролем (P = 0,5912). В настоящее время только 2 человека были проанализированы на инсулин, С-пептид, глюкагон, GLP-1Active и GIPTotal. Однако мы наблюдали ранние и многообещающие нестатистические различия в концентрациях между испытаниями инсулина (красный A, желтый C> зеленый B, белый D), GLP-1Active (красный A, зеленый B, желтый C> белый D), и GIPTotal (красный A> зеленый B, желтый C, белый D).Заключение. Основываясь на этих предварительных результатах, можно сделать вывод, что предварительный прием аминокислотного напитка не влияет на контроль глюкозы у здоровых и малоподвижных молодых людей. Еще неизвестно, оказывает ли предварительный прием аминокислот LEU и ISO какое-либо определенное влияние на секрецию инкретина или последующие реакции инсулина и глюкагона.

    Рекомендуемое цитирование

    Newmire, Daniel E .; Ривас, Эрик; Демер, Сара Э .; и Бен-Эзра, Виктор (2016) «Исследование, сравнивающее предварительно проглоченный L-лейцин и L-изолейцин на гликемический ответ у здоровых неактивных взрослых: предварительные данные., » Международный журнал науки о физических упражнениях: Материалы конференции : Vol. 2 : Вып. 8 , Статья 93.
    Доступно по адресу: https://digitalcommons.wku.edu/ijesab/vol2/iss8/93

    СКАЧАТЬ

    С 26 февраля 2016 г.

    МОНЕТЫ

    Стратегия повышения эффективности производства L-изолейцина в Corynebacterium glutamicum

    MINI-REVIEW

    Стратегия повышения эффективности производства L-изолейцина

    в Corynebacterium glutamicum

    Xiaoyuan Wang

    / Дата публикации: 8 ноября 2018 г. : 6 января 2019 г. / Принято: 7 января 2019 г. / Опубликовано онлайн: 20 января 2019 г.

    # Springer-Verlag GmbH Германия, часть Springer Nature 2019

    Реферат

    Как одна из трех аминокислот с разветвленной цепью, необходимых для человеческого организма , L-изолейцин широко используется в пищевой, медицинской и кормовой

    промышленности.В настоящее время L-изолейцин в основном производится путем микробной ферментации, и основным производственным штаммом является

    Corynebacterium glutamicum. Путь биосинтеза L-изолейцина в C. glutamicum сложен, и активность ключевых ферментов

    и транскрипция ключевых генов этого пути строго регулируются. Внутриклеточно синтезируемый L-изолейцин представляет собой

    , секретируемых переносчиками, и активность переносчиков также регулируется. Эти сложные регуляторные механизмы увеличивают сложность

    для создания L-изолейцин-продуцирующего C.глутамикум. Эта статья посвящена механизму синтеза, секреции и регуляции L-изолейцина биосин-

    у C. glutamicum и рассматривает различные стратегии метаболической инженерии для повышения эффективности продукции изолейцина L-

    у C. glutamicum.

    Ключевые слова Corynebacterium glutamicum .L-изолейцин .Метаболическая инженерия. Аминокислоты с разветвленной цепью .Микробная ферментация

    . Биосинтез L-изолейцина. аминокислоты

    незаменимые для человеческого организма.Он играет важную роль в процессе метаболизма жизни

    с различными физиологическими функциями; поэтому он широко используется в пищевой, медицинской и кормовой

    отраслях (Ямамото и др., 2017; Nieetal, 2018). L-

    изолейцин в основном производится микробной ферментацией;

    Escherichia coli и Corynebacterium glutamicum являются основными производственными штаммами

    (Sun et al. 2012; Beckeretal.

    2018). E. coli обычно синтезирует высокий уровень ацетата, который влияет на выработку L-изолейцина (Sun et al.2012). Производство L-изолейцина

    в E. coli можно улучшить путем оптимизации процесса ферментации

    (Wang et al. 2015a, b), но его выход

    (12 г / л) ниже, чем производство L-изолейцина (32 г / л) в

    C. glutamicum (Yin et al. 2014b). Кроме того, E. coli обычно синтезирует эндотоксин

    (Wang et al. 2015a, 2015b), который может привести к заражению продукта

    . C. glutamicum стал идеальным штаммом

    для продукции L-изолейцина.Большинство штаммов C. glutamicum, продуцирующих L-изолейцин, были получены в результате селекции с мутациями условно

    al, и их дальнейшая модификация была отложена из-за отсутствия геномной информации. Однако за последние

    лет были проанализированы полные геномные последовательности нескольких

    штаммов C. glutamicum (Yang and Yang

    2017), и были разработаны различные инструменты для генетических манипуляций с

    клетками C. glutamicum (Nešvera и

    Патек 2011).Следовательно, возможно и необходимо дальнейшее улучшение производства L-изолейцина

    и снижение затрат на его производство

    C. glutamicum с помощью метаболической инженерии (Park and

    Lee 2010a; Mei et al.2016). Эта статья посвящена последним достижениям

    в области биосинтеза, регуляции метаболизма,

    и метаболической инженерии L-изолейцина в C. glutamicum.

    Производство L-изолейцина

    клетками Corynebacterium glutamicum

    В C.glutamicum, биосинтетический путь L-изолейцина

    сложен (Park and Lee 2010b). Начиная с L-аспартата

    , который образуется из оксалоацетата в цикле трикарбоновой кислоты

    (TCA), биосинтез L-изолейцина включает десять реакций

    (рис.

    Добавить комментарий

    Ваш адрес email не будет опубликован.