Содержание

ЦМВ-инфекция, одна из «поцелуйных» болезней

Цитомегаловирусная инфекция – это заболевание, передающееся половым путем, через слюну, материнское молоко, при беременности (от матери к ребенку), через общую мочалку, полотенце, посуду и т.д. К концу жизни инфицированными этим вирусом оказывается практически сто процентов людей. В большинстве случаев он никак себя не проявляет, но при снижении иммунитета активируется и вызывает болезнь. Вирус может начать действовать в любой части организма, поэтому четкой симптоматики у инфекции нет.

Искоренить вирус нельзя, можно лишь уменьшить его активность. Особенно внимательно к этому вирусу и к его поведению в организме нужно относиться женщинам беременным или планирующим зачать ребенка, поскольку цитомегаловирусная инфекция может вызвать повреждение плода.

Что это такое?

В старые добрые времена ее величали «поцелуйной болезнью», потому как думали, что она передается вместе со слюной. Нынешние медики доказали, что это не совсем так. Возбудитель болезни может находиться не только в слюне, но и в крови, моче, фекалиях, семенной жидкости, секрете шейки матки и материнском молоке. Разумеется, и поцелуя в губы достаточно, чтобы подхватить инфекцию от носителя вируса. Однако того же результата можно добиться, если заняться с ним сексом, выпить из его чашки или поесть из его тарелки, воспользоваться его носовым платком, полотенцем или мочалкой. Кроме того, цитомегаловирусом можно заразиться при переливании крови и пересадке органов, даже в животе у матери будущий ребенок от него не застрахован.

Неутешительные цифры : к 1 году заражен каждый пятый, к 35 годам — 40 процентов населения, а к 50 — все сто. Цитомегаловирусная инфекция считается одним из самых распространенных инфекционных заболеваний.

Возбудитель болезни — Cytomegalovirus hominis — вирус из того же семейства, что и вирус герпеса.

Цитомегаловирус — капризный и привередливый, жить и размножаться он может лишь в очень благоприятных условиях и в определенных клетках. Если ему «что-то не нравится», он ведет себя тихо, зараженный человек пока не болен, он просто является носителем вируса. Но как только организм ослабевает, возбудитель инфекции начинает действовать.

В переводе в греческого цитомегалия — болезнь, при которой «клетки становятся большими». Под влиянием цитомегаловируса клетки теряют способность делиться и одновременно сильно разбухают. Под микроскопом они становятся похожи на глаза совы.

Что происходит?

Оказавшись в клетках человека, цитомегаловирус остается в них навсегда. Независимо от того, каким путем произошло заражение, проявления болезни всегда будут примерно одинаковы. А точнее, никаких проявлений не будет. У большинства инфицированных болезнь протекает в скрытой форме.

Для того чтобы цитомегаловирус активизировался, необходимо снижение иммунитета. Иногда хватает банального авитаминоза, но чаще нужно что-нибудь экстраординарное. Например, СПИД) или прием особых лекарств, понижающих иммунитет (чаще всего они применяются для лечения онкологических заболеваний).

Если цитомегаловирус повреждает слизистые оболочки носа, появляется насморк. При повреждении внутренних органов появляется слабость, поносы-запоры и другие неясные признаки, с которыми, как правило, к врачу не ходят. Тем более, что они через несколько дней сами собой исчезают.

Бывает, что цитомегаловирус поселяется на мочеполовых органах. И тогда у женщин воспаляется матка (эндометрит), шейка матки (цервицит), влагалище (вагинит) и т.п. У мужчин инфекция мочеполовых органов обычно протекает бессимптомно.

Заражение цитомегаловирусом представляет опасность для беременных женщин, поскольку инфекция может передаться развивающемуся эмбриону. Впрочем, если женщина заразилась давно, и инфекция не обостряется, вероятность того, что вирус покалечит будущего ребенка, чрезвычайно низкая. Но при заражении во время беременности, эта вероятность возрастает.

Диагностика и лечение

Самому заподозрить у себя цитомегаловирусную инфекцию практически невозможно. Из всех существующих заболеваний эта болезнь больше всего похожа на банальное ОРЗ. Так же повышается температура, течет из носа и болит горло. Могут увеличиться лимфатические узлы, селезенка и печень. Правда, в отличие от ОРЗ цитомегаловирусная инфекция длится дольше: 1 — 1,5 месяца.

В некоторых случаях единственным признаком болезни является воспаление слюнных желез, в них цитомегаловирус чувствует себя комфортнее всего.

Поставить диагноз «цитомегаловирусная инфекция» может врач-дерматовенеролог. Для этого он вам назначит специальные исследования, которые помогут обнаружить вирус. В образцах крови, слюны, спермы, отделяемого из шейки матки и влагалища, околоплодных вод (при беременности) под микроскопом ищут гигантские клетки или выявляют вирус с помощью ПЦР (ДНК-диагностики). Еще один метод исследования — иммунный: выявление вируса в крови по реакции иммунной системы.

Анализ на цитомегаловирус необходимо делать женщинам, желающим забеременеть.

Цитомегаловирусная инфекция неизлечима. Однако существуют лекарства, позволяющие контролировать количество вируса в организме, сдерживать его развитие. Больным повышают иммунитет и назначают специальные противовирусные препараты.

Эти же мероприятия проводятся при обнаружении цитомегаловируса у беременной или собирающейся забеременеть женщины на протяжении всего периода вынашивания ребёнка и лактации. Используется весь комплекс препаратов, повышающих иммунитет, а также применяются подавляющие размножение вируса препараты интерферона. Инфицированная беременная женщина должна с интервалом 10-12 дней сдавать анализы. Также следует постоянно следить за состоянием эмбриона.

Тщательно подобранная мощная терапия и строгое выполнение рекомендаций врача позволяют значительно снизить риск передачи инфекции ребёнку, который впрямую зависит от активности вируса в организме матери.

герпес, цитомегаловирус, вирус Эпштейна-Барра и другие инфекции (вопрос 48-

Герпесвирусные инфекции: герпес, цитомегаловирус, вирус Эпштейна-Барр и другие инфекции.

Вопрос 48. Моему сыну 3 года. Он родился доношенным: 2 800 г. и 48 см. Вес набирает очень плохо. В год весил 7 800 и 72 см, в 2 года — 9 500 г. и 82, а в 2, 2 года — всего 10 500. За последний год вес вообще не набирает. В 3,2 года весит 10 500 и 87 см. Ест, в общем- то, плохо. Никаких отставаний в развитии нет, врачи вроде тоже ничего не нашли. Педиатр предположил, что может быть хроническая инфекция. У меня во время беременности были не в норме ВПГ и цитомеголовирус. Как проверить, есть ли инфекция у ребенка? Какие анализы нужно сдать? Может ли какая-нибудь инфекция влиять на набор веса и рост?

Ответ 48. Да, причиной отставания детей в физическом развитии действительно могут быть врожденные инфекции. Поэтому ребенку показано ИФА и ПЦР обследование на врожденные хронические герпетические инфекции (ВПГ, ЦМВ и обязательно – вирус Эпштейна-Барр). Кроме того, — иммунный статус, УЗИ органов брюшной полости, консультация гастроэнтеролога для исключения врожденных аномалий пищеварения или обмена веществ и, возможно, консультация эндокринолога, для исключения гипонанизма (гормональная задержка роста).

Вопрос 49. Я занимаюсь в бассейне аквааэробикой, сейчас узнала, что бассейн собирается посещать одна знакомая, у которой обнаружены несколько из TORCH-инфекций (если не ошибаюсь, цитомегаловирус и папилломавирус). Скажите, есть какая-то вероятность передачи инфекции через воду? Спасибо.

Ответ 49. Нет, TORCH-инфекции, которые имеют много других путей передачи, в том числе один из самых опасных – трансплацентарный во время беременности, через воду не передаются. Тем более, что в бассейнах вода постоянно проходит обеззараживание хлорированием или ионизацией. И потом, практически у каждого взрослого уже есть свой цитомегаловирус и свой папилломавирус в форме хронического латентного (неопасного) инфицирования. Поэтому «чужие» вирусы этой группы нам, как правило, не страшны.

Вопрос 50. Здравствуйте! У моего 12-летнего сына прямо под носом (возле дырочек, я не знаю, как яснее сказать) образовались пузырьки, как герпес на губах. Это появилось у него сразу после насморка. Наверно, руками занес инфекцию, когда у него раньше был герпес на губах. Можно ли его также смазывать герпевиром? Что наиболее эффективнее использовать при герпесе? У меня тоже часто после переохлаждения бывают пузырьки на губах. Может попринимать что-нибудь гомеопатическое или иммуномодулятор?

Ответ 50. Эти высыпания у ребенка — тоже герпес. Смазывать герпевиром можно, гомеопатические препараты (например, Энгистол) принимать можно. А вот ацикловиры и иммуномодуляторы самостоятельно лучше не принимать.

Вопрос 51. Я читала, что Вальтрекс очень хороший препарат, намного лучше Ацикловира. Я читала, что курс лечения 5 дней, это для подавления вируса. Но хватит ли этих 5 дней, если я хочу, чтобы межрецидивные периоды были как можно дольше. В аннотации к Вальтрексу написано, что для профилактики рецидивов его нужно принимать как минимум полгода, только в том случае можно добиться того, что рецидивы будут нечастыми. И еще хотела спросить: можно ли все эти препараты ацикловир, вальтрекс и Фамвир принимать во время беременности? Дело в том, что я еще не знаю, беременна я или нет?

Ответ 51. Вальтрекс очень хороший препарат. Но противорецидивным эффектом он не обладает – после его отмены иммунологическая ситуация с противостоянием организма вирусу не изменяется. Поэтому профилактический эффект сохраняется только на время приема препарата, который в некоторых западных странах рекомендуют принимать непрерывно в супрессивной дозе (1 таблетка утром) до 5 лет. Во время беременности все перечисленные препараты принимать не рекомендуют.

Вопрос 52. Здравствуйте! У меня ЦМВ (сдавала только мазок на ЦМВ), других инфекций нет. Я собираюсь скоро выходить замуж, но еще у нас не было половых контактов. Очень переживаю, что заражу мужа ЦМВ (даже если и пользоваться презервативом, то оральный секс, которым хочет заниматься мой любимый, все равно приведет к заражению). И ребенка мы хотим скоро (во время этого процесса он уж точно заразится). Не знаю, что делать. Может быть, за границей ЦМВ успешно выводят из организма? Для меня это проблема №1. Пожалуйста, помогите!

Ответ 52. Здравстуйте! ЦМВ не выводят из организма нигде: ни в Киеве, ни заграницей. П.ч. ЦМВ в генетическом плане – это часть генома человека. ЦМВ, обнаруженый в эпителии урогенитального тракта, лечению не подлежит и опасности для плода практически не представляет. Непосредственно перед и во время беременности необходимо проходить ПЦР-тесты на репликативную активность этого вируса путем исследования крови, слюны и мочи. Для мужа Ваш вирус опасности не представляет, п.ч. в организме 92% и более взрослых есть свой ЦМВ, которым мы инфицированы хронически и зачастую – с детства.

Вопрос 53. Добрый день! Ребенку 3 года. 1, 5 года назад на обследовании в РДКБ была выявлена врожденная ЦМВ-инфекция. При выписке рекомендовали схему лечения Вифероном: 10 дней утром и вечером Виферон-3. Далее в течение 3 мес все это через день. Недавно лежали в больнице в Казанской республиканской клинике, где рекомендовали проводить терапию Вифероном 1 раз в год по московской схеме, но она для нас очень ударная. После нескольких дней ребенок начинает реагировать на каждую свечу. Посоветуйте, пожалуйста, схему приема. В Москве корректировать схему отказываются по телефону, нужно приезжать с ребенком, а девочка очень часто болеет с высокой температурой. Спасибо!

Ответ 53. Добрый день! Во-первых, монотерапия вифероном при врожденной цитомегловирусной инфекции вообще мало эффективна. Во-вторых, 5 млн виферона в сутки для ребенка 3 лет – действительно ударная доза. Препарат назначают из расчета 3 млн на 1 кв.м поверхности тела (по таблицам), но не более 3 млн в сутки. И, в-третьих, при врожденной ЦМВ-инфекции каждый дополнительный и новый курс лечения проводят только после определение репликативной активности вируса – обнаружения методом ПЦР вирусной ДНК в крови, слюне и/или моче. Если ПЦР-тесты отрицательные, то противовирусное лечение вообще не показано.

Вопрос 54. У меня, судя по всему, генитальный герпес. Откуда взялся — сложно сказать, но был период в жизни… Диагноз себе поставила сама, по описанию, найденному в интернете. Уже неделю мучаюсь с момента появления пузырьков. Некоторые уже полопались, другие нет. Принимаю арбидол и мультивитамины. Очень отекают половые губы. Даже ноги немеют и поясницу ломит. В туалет ходить больно нестерпимо. Только если поливать холодной водой… Про мази и таблетки противогерпетические прочла, что они эффекта практически не дают. Но состояние настолько угнетает, что уже не знаю, как поступить. Подскажите, пожалуйста!

Ответ 54. Мази и таблетки на основе ацикловира достаточно эффективны в плане прекращения острых явлений генитального герпеса – можете смело и безотлагательно их применять. Противорецидивным эффектом они, к сожалению, не обладают. Если рецидив повторится и Вы захотите провести противорецидивное лечение – можете обратиться к нам в клинику.

Вопрос 55. Подскажите, пожалуйста, стоит ли мне лечиться (и как), если последние анализы показали следующее: Герпес IgG 1 тип — позитивный 1,334 S/CO, Герпес IgG 2 тип — негативный 0,281 S/CO, Цитомегаловирус IgG — позитивный 2,848 IU/ml, Герпес 1/2 ПЛР (у/г) — негативный, Цитомегаловирус ПЛР — (у/г) негативный. Дело в том, что у меня уже есть один ребенок, и в ближайшем будущем я планирую еще одну беремнность. Когда первый раз у меня были такого рода показатели, я пролечилась разными назначенными антибиотиками. Теперь вот опять сдала анализы — результат почти аналогичный. Как понять, что происходит, и что мне может грозить при беременности. Заранее спасибо.

Ответ 55. Ответ отрицательный: результаты приведенных анализов сами по себе еще не являются показанием для лечения этих инфекций. Это норма для женщины, планирующей беременность. Более того, изменение или сохранение на прежнем уровне этих показателей не отражает эффективность противовирусной терапии (антибиотики на эти вирусы не действуют). Для установления активности этих вирусов необходимо провести дополнительно ПЦР-тесты (кровь, слюна, моча, а не урогенитальный соскоб!) сейчас, до беременности, а затем еще 5-6 раз во время беременности. П.ч. невозможно предугадать в какие сроки беременности они могут активизироваться. Опасность же для ребенка представляют и требуют лечения только активные формы этих инфекций.

Вопрос 56. Полгода назад я болел мононуклеозом. Полгода держал строгую диету и спортом не занимался. Могу ли я теперь заниматься спортом в полной мере, питаться без ограничений и разрешены ли мне теперь спиртные напитки? Если нет, то на протяжении какого времени мне нужно еще ограничить себя?

Ответ 56. Для академически корректного ответа на Ваш вопрос необходимо пройти полное обследование на вирус Эпштейна-Барр (ВЭБ) – ИФА и ПЦР, а также сделать общий анализ крови.

Вопрос 57. Добрый день! Подскажите, пожалуйста, как бороться с герпесом, обострившимся в период грудного вскармливания (ребенку 4 мес). Возможно ли применение мази Герпевир-КМП? В период беременности один раз было обострение — врач порекомендовала эту мазь, оказалось эффективно! Хотя, я понимаю, что в дальнейшем необходимо пройти более серьезный курс лечения…

Ответ 57. Добрый день! Ответ утвердительный: мазь Герпевир можно безопасно применять в период кормления грудью. После завершения лактации рецидивы герпеса могут прекратиться сами по себе. Поэтому не спешите пока что с системным лечением ацикловирами и иммуномодулирующими препаратами.

Вопрос 58. У моего партнера выявили герпес полового члена. Это возможно вылечить насовсем? И чем лечить. Хочется глобально: и наружно, и внутри. Посоветуйте, что делать. Это очень плохо?

Ответ 58. Вылечить «насовсем» нельзя. Но можно на длительный период перевести эту инфекцию в латентную форму без клинических рецидивов. Это не смертельно и в период, когда высыпаний нет, не опасно при половых контактах. Поэтому из-за генитального герпеса, который может больше никогда не повториться и присутствует в скрытой форме почти у 90% взрослых, вряд ли стоит менять полового партнера. С ним еще смело можно пожить.

Вопрос 59. Здраствуйте! У меня вагинальный герпес. Беспокоит меня это заболевание около 6 лет. Сейчас сильное обострение. Для определения схемы лечения доктор назначает анализы по крови на иммуноглобулины М и G. Есть ли необходимость в моем случае делать оба или достаточно только G? Нужно ли делать ПЦР и комплексную иммунограмму?

Ответ 59. В целях экономии средств, если диагноз у доктора не вызывает сомнения по внешним признакам, можно сделать только 1 анализ: исследовать содержимое пузырька на ДНК ВПГ 1 и 2 типов. Проведение комплексной иммунограммы перед началом лечения не помешает.

Вопрос 60. Вопрос д-ру Маркову. У девушки (16 лет) геморрагический васкулит. Анализ показал наличие антител к цитомегаловирусу (64 при норме до 10). Подскажите, пожалуйста, насколько это серьеозно и что делать в данной ситуации?

Ответ 60. Необходимо определить активность ЦМВ (антитела IgМ в крови и ПЦР-тесты на ДНК ЦМВ в крови, слюне и моче), а также дополнительно пройти полное обследование на вирус Эпштейна-Барр (ИФА и ПЦР), который даже чаще ЦМВ может приводить к развитию геморрагического васкулита. При отсутствии активности этих вирусов в динамике (ПЦР-мониторинг в течение 3-6 мес) – это просто хроническое микст-инфицирование у больного с васкулитом. При выявлении вирусной репликации необходимо обсуждать вопросы проведения противовирусной терапии.

Вопрос 61. Уважаемый доктор, здравствуйте. Очень надеюсь на Ваш ответ. Моему ребенку 2,5 года и у него методом ПЦР обнаружен ЦМВ на два плюса. Проходим лечение. Одновременно сдала анализы сама — прокомментируйте, пожалуйста, их результаты. По методу ПЦР: хламидии, микоплазма, уреаплазма, герпес – все отрицательно; иммуноферментный анализ крови на цитомегаловирус IgM — отр, IgG — 1,7, на герпес IgM — отр, IgG — 3,4. Т.е. IgG, как видно из бланка анализа, показывает анамнестические антитела. Что это такое и требуется ли мне лечение? Нужно ли мне еще дополнительное обследование? Возможно ли при таких показателях заражение от меня ребенка цитомегаловирусом в прошлом и сейчас? Спасибо.

Ответ 61. Вы хронически инфицированы цитомегаловирусом. Пока вирус в латентном состоянии (не активном) – лечение Вам не показано. При реактивации вируса (позитивные ПЦР-тесты на ДНК ЦМВ в крови, слюне и/или моче) Вы могли быть источником заражения ребенка даже во время беременности (через плаценту). Сейчас Ваш вирус, даже если он находится в активном состоянии (в этом случае необходимо обсуждать показания для Вашего лечения), уже опасности для ребенка не представляет – у него есть свой вирус. И активность этого вируса зависит теперь от уровня собственной иммунологической защиты организма ребенка. О необходимости лечения ребенка от ЦМВ и качества такого лечения выссказаться определенно не могу — мало представленной информации.

Вопрос 62. Здравствуйте! Пожалуйста, помогите, не знаю уже, что делать. В месяц ребенку был поставлен диагноз: внутриутробная цитомегалловирусная инфекция, была обнаружена ДНК ЦМВ в крови (один плюс из четырёх возможных). Симптомами была желтуха, увеличение печени и увеличеная вилочковая железа (2-3 степень, сейчас в норме). Мы пролечились: капли Протефлазид, свечи Виферон-1 и сделали 5 уколов анти-ЦМВ иммуноглобулина. После лечения снова сдали анализ: в слюне и моче обнаружен. Мы еще раз пролечились для контроля и врачи сказали больше до следующего года не беспокоиться. В этом году (ребенку год и месяц) мы снова сдали ПЦР крови и слюны: в крови — два плюса, в слюне — три. Инфекционист сказал, что такое возможно после перенесенной простуды (дочка до этого за пару недель переболела ОРВИ средней формы тяжести) или из-за любого снижающего иммунитет фактора. Сказал сдать еще некоторые анализы, особо не спешить, закаливать ребенка. И вот вчера снова какая-то инфекция, температура 39 даже ночью, горло красное, похоже на ангину. Лечим амизоном, интерфероном, сбиваю температуру Эффералганом. Но вопрос в том, что в данном случае делать с ЦМВ? Ведь я так понимаю, это он способствует снижению иммунитета. А заболевания, как мне объяснили, в свою очередь вызывают большее распространение ЦМВ. Как вырваться из этого замкнутого круга? У нас, к сожалению, нет сейчас ни одного толкового инфекциониста. Мне даже не к кому обратиться. Вопрос первый: нужно ли сейчас срочно лечить ЦМВ? И чем его лечить? Протефлазид не очень-то помог. Или стоит разобраться сначала с ангиной (или что это ещё), а потом лечить? Если не срочно, то я могу приехать в Киев на консультацию со всеми анализами. Забыла добавить: ребенок развивается нормально, согласно возрасту, у невролога всё в порядке, у других специалистов тоже. Простудными в первый год почти не болела, только один раз легкой формой ОРВИ. Прививок нет (был отвод по тимомегалии), кроме роддомовских БЦЖ и гепатита В. Пожалуйста, просветите меня по нашей проблеме. Спасибо заранее.

Ответ 62. Здравствуйте. По порядку. 1) Если последние анализы на активность ЦМВ (обнаружение ДНК в крови) не врут, что исключить нельзя, ребенку показано срочное лечение от ЦМВ. «Здоровое» вирусовыделение, которое действительно не требует лечения, возможно только со слюной. Обнаружение вируса в крови требует повторного проведения вируснейтрализующей терапии. 2) Препараты, которые Вам назначали для лечения ЦМВ, на этот вирус практически не действуют. Основными препаратами в таком возрасте и при такой клинике (отсутствие прямой угрозы для жизни) являются: а) Цитобин – высокотитрованный иммуноглобулин против ЦМВ в/м; б) эрбисол-ультрафарм в/м; в) рекомбинантный интерферон в/м или виферон в свячах. 3) Ангина вряд ли имеет прямое отношение к ЦМВ. Поэтому необходимо сначала пролечить ангину, желательно – без применения антибиотиков. Отсутствие частых простудных заболеваний и неврологических симптомов – это положительные моменты для ребенка с врожденной цитомегаловирусной инфекцией. Кроме того, на ребенка работает само время: с каждым месяцем иммунная система ребенка крепнет и возрастает вероятность самопроизвольного (под воздействием иммунитета) без лечения перехода ЦМВ-инфекции из активного состояния в латентное. Поэтому нужно чаще проводить ПЦР-тесты: это помогает определиться с направлением движения активности ЦМВ в сторону затухания или нарастания активности. Приезжайте в Киев в любой момент, предварительно записавшись на прием по телефону.

Вопрос 63. Добрый день! У моего ребенка (2 года) инфекционный мононуклеоз. Возможно ли заражение матери от ребенка, так как начинаю наблюдать схожие симптомы. И подскажите еще, пожалуйста, что нам лучше принимать, чтобы восстановить организм ребенка после болезни и приема антибиотиков (флемоксин солютаб и сумамед — назначение врачей). Заранее спасибо.

Ответ 63. Добрый день! Заражение от ребенка возможно, если только у Вас нет хронической ВЭБ-инфекции. В этом случае чужой вирус, в т.ч. и от ребенка, Вам уже не опасен и острого эпизода ВЭБ-инфекции (инфекционный мононуклеоз) быть не может. У ребенка необходимо проконтролировать полноту выздоровления после этой болезни. Сегодня на все эти вопросы можно ответить после исследования крови на антитела 3-х классов к ВЭБ и вирусную ДНК в крови и слюне. После антибиотиков желательно принимать препараты для лечения дисбактериоза кишечника (пробиотики).

Вопрос 64. Здравствуйте! У меня тоже вопросы по поводу этих проклятых вирусов. У меня были обнаружены хронические ЦМВ и герпес. ЦМВ совсем немного, а вот герпес выше нормы. Сейчас заканчиваю противирусное лечение. Я посоветовала своему бойфренду тоже сдать анализы и пройтие лечение. Но его доктор даже не стал брать кровь на анализ, заявив, что эти вирусы есть у всех, и для его спокойствия прописал ему только Арилин 500 (метронидазол). Видимо, в Швейцарии люди с более сильным имунитетом и им не страшны эти вирусы. Что мне делать? Я боюсь, что все мое лечение будет бесполезным. Все время пользоваться презервативом нереально, тем более что мы планируем завести ребенка. Подскажите, пожалуйста, как мне быть в этой ситуации?

Ответ 64. Здравствуйте! По порядку. 1) Повышенные титры антител к ЦМВ или ВПГ не являются поводом для назначения и тем более проведения противовирусного лечения. Поэтому, похоже, Вас напрасно лечили. 2) Меторонидазол вообще не относится к противовирусным препаратам и для лечения герпеса его не применяют ни в Украине, ни в Швейцарии. 3) Герпесвирусы, если они находятся в активной форме, страшны в любой географической точке независимо от национальности человека. 4) Пользоваться презервативом в такой ситуации совершенно необязательно: Вам не страшен чужой вирус (даже если он есть у Вашего партнера), п.ч. у Вас есть собственный. Он может быть более опасен, чем чужой. 5) Если Ваши вирусы находятся в латентной форме (отсутствие высыпаний и отрицательные результаты ПЦР-исследования на вирусную ДНК), то Вы можете смело планировать беременность. Однако во время беременности необходимо продолжать контролировать активность ВПГ, ЦМВ, а также вируса Эпштейна-Барр. В случае их реактивации показано быстрое проведение вируснейтрализующей терапии.

Вопрос 65. Здравствуйте! Расскажите, пожалуйста, о вирусе Эпштейна-Барр: что это такое, как им можно заразиться и правда ли, что при этом вирусе человек хронически устает, и лечится ли этот вирус? Беспокоюсь еще и о том, отражается ли это на ребенке: будучи беременной, сдавала анализы на ТORCH, выявлен был этот Эпштейна-Барр. Спасибо!

Ответ 65. Вирусом Эпштейна-Барр (4-й герпесвирус) инфицированы до 95-97% взрослых. Заражаются обычно еще в детском возрасте воздушно-капельным и бытовым путем, возможно также — внутриутробно. Острая форма (0,1% инфицированных) называется инфекционный мононуклеоз. В случае активизации ВЭБ могут развиваться различные синдромы и болезни, в том числе синдром хронической усталости. Внутриутробное инфицирование плода может иметь самые негативные последствия, как ближайшие, так и отдаленные. Поэтому для прояснения ситуации показано обследование ребенка на этот вирус и его активность.

Вопрос 66. Здравствуйте, пожалуйста, посоветуйте, что стоит предпринять при обострении герпеса на слизистой рта: болезненные язвы и отек каждый раз после стоматологической анестезии, после случайных травм десен или языка. Герпес диагностирован по мазку. Кроме слизистой рта больше нигде не проявлялся. Спасибо. Олеся.

Ответ 66. Здравствуйте, Олеся! Все зависит от того, к какому варианту лечения Вы уже «созрели». Для эпизодического лечения в момент обострения достаточно принять по 2 таблетки вальтрекса утром и вечером в течение 3-5 дней и местно использовать 1%-ный спиртовый раствор метиленовой синьки. Для лечения с ближайшим профилактическим эффектом (на 3-6 месяцев, возможно индивидуально больше) – препарат герпебин по 0,2-0,15 мл на кг массы тела на одну внутримышечную инъекцию 1 раз в день ежедневно или через день до 5 раз. Для профилактического лечения с отдаленным положительным эффектом необходимо сочетание пассивной иммунизации герпебином с последующей через 3-4 недели активной иммунизацией герпетической вакциной на фоне непрерывной супрессивной терапии вальтрексом (1 таблетка в сутки). Такое лечение занимает около 2,5-3 месяцев.

Вопрос 67. Добрый вечер! Подскажите, пожалуйста, по результатам анализа ИФА обнаружили: антитела IgG к вирусу герпеса 1:6400, антитела IgG к цитомегаловирусу 1:800. Назначено лечение — ацикловир Стада по 200 мг 5 раз в день 5 дней, потом по 200 4 раза в день 2 недели. Спринцевание влагалища раствором Бетадина 2 раза в день и тампон с мазью Ацикловир 2 раза в день в течение 8 часов. Фитовит по 1 капсуле в день 1 месяц. Дело в том, что в период обострения, т.е, когда высыпали пузырьки, начались месячные и я не смогла спринцеваться и ставить тампоны. В инструкции написано, что всё это надо делать при первых проявлениях. С раствором бетадина не понятно как применять и нужно ли, в инструкции по ацикловиру Стада написано, что может быть диффузное выпадение волос, они у меня до этого и сейчас очень выпадают. Не могли бы вы прокомментировать эти лекарства и можно ли их применять после рецидива? По поводу цитомегаловируса врач сказал лечить, когда вылечу герпес. Наталья. Ответ 67. Добрый вечер, Наталья! Антитела к вирусу герпеса и к цитомегаловирусу не являются показанием для назначения лечения и критерием эффективности такого лечения. Поэтому Ваш цитомегаловирус вообще в лечении не нуждается. Если же поводом для лечения является рецидивирующий генитальный герпес, то такое лечение лучше начинать как раз в момент рецидива. При этом, поскольку причинами рецидивирующего генитиального герпеса являются проблемы со специфическим иммунитетом, местное лечение вообще мало эффективно как метод предупреждения следующего рецидива и может применяться только с целью уменьшения болевого синдрома или для ускорения эпителизации. Наиболее успешным противорецидивным эффектом обладает комбинированная терапия: сочетание пассивной иммунизации (5 в/м инъекций) специфическим титрованным иммуноглобулином человека против HSV ? (Герпебин) и последующей через 3-4 недели активной иммунизации герпетической вакциной (10 внутрикожных инъекций по определенной схеме). Весь курс лечения составляет 2,5-3 месяца и выполняется на фоне постоянной супрессивной терапии вальтрексом – по 1 таблетке в день.

Продолжение вопроса 67. Спасибо за ответ! Подскажите, пожалуйста, как правильно, каким методом мне и мужу сдать анализы на вирус герпеса и цитомегаловирус, т.е, кровь, мазок и т.д? Чего не стоит делать перед анализами, на какой день месячных. Мы не можем понять, я сдала анализы на антитела IgG к вирусу герпеса 12 типа — 1:6400, антитела IgG к ЦМВ — 1:800, антитела IgG к вирусу краснухи — 1:3200. Перед месячными 10 ноября появились во влагалище прыщики и сильно чесалось, врач сказал, что это герпес, я сдала анализы и он определил, что это герпес. А вы говорите, что антитела не являются показанием для лечения. Посоветуйте, пожалуйста, какие анализы мне с мужем надо сдать. Антитела к микоплазме, уреаплазме, хламидиям, всем типам папилломавирусов (соскоб), трихомониаз — не обнаружены. Спасибо большое. Дополнительный ответ 67. Анализы, которые Вы сдали, подтвердил лишь факт наличия в Вашем организме вируса простого герпеса. А не «определил», что высыпания являются герпетическими. Показанием для лечения генитального герпеса является сам факт клинического рецидивирования герпетических высыпаний на половых органах. Для начала такого лечения вообще никаких анализов сдавать больше не нужно. Если же есть сомнения в том, что высыпания связаны с герпесом, необходимо взять непосредственно содержимое пузырька на анализ для определения ДНК вируса простого герпеса 1 и/или 2 типов методом ПЦР. Если у мужа нет герпетических высыпаний, то обследовать и лечить его вообще не нужно – не теряйте время и деньги и занимайтесь только собой. Повторяю: антитела к цитомегаловирусу (так же как и к вирусу простого герпеса) и их титры/высота не являются показанием для лечения. Единственным показанием для лечения ЦМВ является обнаружение его ДНК в крови, слюне, моче или других биологических жидкостях организма методом ПЦР. Подробнее и популярно читайте в завтрашнем (от 3.12.2004) номере газеты «Факты».

Вопрос 68. Игорь Семенович, здравствуйте! Хочу задать вопрос опять-таки по поводу цитомегаловируса. Два месяца назад ЦМВ был обнаружен при исследовании урогенитального материала методом ПЦР. Было назначено противовирусное лечение, которое я, естественно поставила под сомнение, поскольку: 1) лечение дорогое и агрессивное и 2) врач для подтверждения диагноза отправила на анализ CMV IgG. Читала много информации в интернете. Сдавала анализы крови CMV IgG и IgM еще в 2-х лабораториях. Вот собственно мой вопрос: если результат анализов CMV IgG — положительный, а IgM — отрицательный, обязательно ли сдавать анализ ПЦР ЦМВ в крови, слюне, моче и анализ на клетки-цитомегалы в слюне и моче? Т.е. является ли отрицательный IgM поводом однозначно утверждать, что в данный момент активности вируса нет? Еще один вопрос: TORCH-комплекс, а также EBV перед беременностью нужно сдавать методом ПЦР в крови, слюне, моче или достаточно ИФА-метода? Заранее большое Вам спасибо! Наталья.

Ответ 68. Здравствуйте, Наталья! 1) Нет, не является. Только при острых инфекциях антитела класса IgM обнаруживают в 100% случаев. Т.е. нет антител IgM – нет и такой инфекции. При хронических инфекциях, в том числе герпетических, в момент реактивации антитела IgM, по нашим данным, появляются не более, чем в 15-18% случаев (в зависимости от конкретного вируса). Поэтому, при наличии серологического маркера CMV-инфекции (антитела IgG), единственными критериями репликации вируса является обнаружение вирусной ДНК при ПЦР-исследовании крови, слюны и мочи (нельзя заменить только исследованием одного материала!, напр., крови) или клеток-цитомегалов в слюне и моче. 2) После установления герпесвирусного «меню», и перед бременностью, и в дальнейшем 5-7 раз во время беременности необходимо сдавать только ПЦР тесты: на HSV — в крови, на EBV — в крови и слюне, на CMV – в крови, слюне и моче. И, наконец, последнее. Впервые я общаюсь с пациенткой, которая поняла суть проблемы лучше и глубже, чем многие врачи. Очень приятно.

Вопрос 69. Можно ли для подавления герпеса и цитомегаловируса (при наличии онкозаболевания) использовать иммуноглобулины человека против TORCH-инфекций? Простите, что отнимаю время. Василий.

Ответ 69. Здравствуйте, Василий! Одним из наиболее безопасных и адекватных методов защиты от герпесвирусов при наличии иммунодефицитных состояний, к которым могут быть отнесены и онкозаболевания, относится применение специфических высокотитрованных иммуноглобулинов человека – Герпебина или Цитобина. Продолжительность действия этих препаратов – 6-8 недель. Показанием для повторного введения являются либо клинические рецидивы герпетической инфекции, либо обнаружение ДНК HSV или CMV методом ПЦР.

Вопрос 70. Что из препаратов Вы посоветуете для поднятия иммунитета при наличии вируса герпеса? Мне были рекомендованы «Протефлазид», «Иммунал». Возможно, нужно, что-то добавить из фруктов или овощей?

Ответ 70. Если у Вас нет клинических проявлений ВПГ, то никаких препаратов для «поднятия иммунитета» принимать не нужно. П.ч. можно получить обратный эффект: спровоцировать рецидив герпетической инфекции. Это касается и перечисленных препаратов, и любых других. Можете добавить овощи и фрукты, но основное правило: избегать факторов, провоцирующих появление клинических симптомов ВПГ (стресс, переутомление, инфекционные заболевания, голодание и плохое питание, прием антибиотиков, длительное пребывание на солнце и проч.).

Вопрос 71. Здравствуйте, помогите, пожалуйста, разобраться в ситуации с ЦМВ. При сдаче анализа на ЦМВ методом ПЦР в прайсе лазерного центра, куда я обратилась, обнаружила аналогичные анализы в разделах Офтальмология, Гинекология, Педиатрия — насколько я понимаю, берется из разных мест. Разве одного анализа ПЦР (например, из ротовой полости) не достаточно, чтобы определиться с наличием этого вируса и его активностью? Или может так получиться, что, например, по гинекологии ПЦР на ЦМВ отрицательный, а по анализу из глаз он присутствует, или наоборот? Так бывает? По каким признакам я, как носитель ЦМВ, могу судить об активизации у меня цитомегаловирусной инфекции (например, температура, насморк, и т.п.)? Или таких симптомов не существует? Какова тактика поведения при наличии ЦМВ (как не стать источником заражения и сохранить свое здоровье)? Спасибо.

Ответ 71. Нет, одного анализа не достаточно. Необходимо исследовать кровь, слюну, мочу (обязательно) + биоматериал из очага поражения (слеза, ликвор, соскоб т п.). Именно эти тесты и являются критериями активности вируса, при этом вирус никогда не обнаруживается одновременно во всех исследуемых образцах. Обострение хронической ЦМВ-инфекции обычно не имеет клинических проявлений, а температура, увеличение лимфоузлов, фарингит, синдром хронической усталости могут быть и при других инфекция. Профилактического лечения хронической ЦМВ-инфекции, которая находится в латентной форме, не существует. Никаких эпидемиологических ограничений для носителей ЦВМ не существует, п.ч. эта инфекция распространена повсеместно и при инфицировании ею после рождения особой опасности не представляет. Здоровье помогает сохранить здоровый образ жизни с минимальным количеством вредных привычек.

Вопрос 72. Здравствуйте! Уважаемые доктора, ответте, пожалуйста, есть ли угроза выкидыша или смерти ребенка после рождения, в случае наличия у мамы цитомегаловируса или герпесвируса? Спасибо.

Ответ 72. Угроза для плода или новорожденного может быть только в случае активации этих вирусов во время беременности. Ее необходимо контролировать методом ПЦР-исследования 5-7 раз планово и при необходимости – проводить вируснейтрализующую терапию. Вероятность такой активации при неотягощенном акушерском анамнезе составляет до 10% (при 94-95% инфицирования женщин детородного возраста этими вирусами).

Вопрос 73. Здравствуйте! Я три недели пролечилась в офтальмологии от увеита, причем рецидива увеита — в прошлом году у меня уже было подобное заболевание. Так вот, врач говорит, что увеит вызывает герпес. Мы с мужем планируем ребенка, скажите, как можно обезопаситься от рецидивов, как укрепить иммунитет?

Ответ 73. Вам показано и в связи с увеитом, и в связи с планируемой беременностью обследование на все вирусы герпеса: сначала ИФА, затем – ПЦР. Выявленные герпесвирусы, если они в неактивной форме, подлежит ПЦР-мониторированию 5-6 раз планово во время беременности – на случай их реактивации.

Вопрос 74. Добрый день! Расскажите, пожалуйста, про вирус Эпштейна-Барр (4 тип). У моей сестры был выкидыш месяц назад (беременность планировала). Ей 26 лет, после сдачи анализов выявлен указанный вирус. Как он может отразиться на ее здоровье (болей никаких нет) и на дальнейшее зачатие и вынашивание ребенка (через полгода планирует опять забеременеть). Пожалуйста, отзовитесь!!!

Ответ 74. Здоровью Вашей сестры этот герпесвирус вряд ли угрожает. А вот при новой беременности снова может быть опасен. Вашей сестре необходимо найти лечащего врача-инфекциониста и регулярно (6-7 раз) во время следующей беременности проводить ПЦР-мониторинг (ДНК ВЭБ в крови и слюне) за активностью этого вируса. При выявлении его реактивации – провести вируснейтрализающую терапию препаратом Вирабин в/м.

Вопрос 75. Здравствуйте, у меня такая проблема. Обострился половой герпес после простуды… Без визикул, просто сильная гиперемия, зуд и жжение. Намазала герпевиром, пью энгистол. Проблема в том, что у меня детка 4,5 месяца полностью на грудном вскармливании. Как же мне теперь избавиться от этой заразы? Герпевир при ГВ нельзя… Скажите еще — ребенок может от меня заразиться? Я сама тоже врач… Но как дело доходит до собственного здоровья и здоровья детки я просто тупею на глазах и не знаю что мне делать, забываю все, что учила год назад… Спасибо всем огромное. С уважением, Анна.

Ответ 75. Здравствуйте, Аня. Я тоже врач и тоже тупею, когда болеют мои дети. Хотя они, к счастью, уже взрослые и болеют редко. Во-первых, это может быть не герпес. Во-вторых, вирус генитального герпеса, как правило, не передается с грудным молоком, и, в-третьих, Ваш ребенок все равно раньше или позже заразится ВПГ. Хотя если он не получил этот вирус внутриутробно, он вряд ли будет для него опасен. Будьте здоровы.

Вопрос 76. Здравствуйте! В роддоме у меня обнаружили цетомегаловирус. Ребенку сейчас 10 месяцев. Передалась ли ему эта инфекция? Как и чем мне следует пролечиться?

Ответ 76. Здравствуйте! Вам лечиться не нужно. Показано обследование на активность этого вируса (методом ПЦР на наличие ДНК ЦМВ в крови, слюне и моче) перед следующей беременностью и 5-7 раз во время беременности. Ребенка желательно проверить на наличие врожденной ЦМВ-инфекции: антитела IgG и IgМ к ЦМВ методом ИФА и ДНК вируса методом ПЦР в крови, слюне и моче.

Вопрос 77. Ответьте, пожалуйста, может ли наличие вируса герпеса в крови вызывать увеличение подмышечных лимфоузлов?

Ответ 77. Во-первых, для ВПГ это не характерно – это могут быть симптомы ЦМВ- или ВЭБ-герпетических инфекций. А, во-вторых, у Вас в крови, скорее всего, обнаружены антитела к ВПГ, а не сам вирус. А это совершенно разные вещи – обнаружение антител в крови является вариантом нормы, и заболеванием это не считают.

Вопрос 78. Здравствуйте. Два месяца назад у меня обнаружили легкую дисплазию и эрозию, в мазке — вирус герпеса, анализ крови на антитела к вирусу простого герпеса ? типов — положительный. Решили лечиться. Пролечилась: месяц Вальтрекс, Протефлазид, Виферон и спрей (название забыла). После лечения прошло две недели. К прежнему врачу идти не хочу, поэтому спрашиваю здесь. Скажите, пожалуйста, когда лучше идти к врачу на приём по поводу дисплазии и эрозии? И когда лучше сделать анализ крови на герпес, чтобы титры были маленькими (это необходимо для страховой компании)? Заранее благодарна за ответ, Елена

Ответ 78. Здравствуйте, Елена. К сожалению, все не правильно. Обнаружение вируса герпеса в урогенитальном мазке (при отсутствии герпетических высыпаний — везикул) и положительные титры антител не являются поводом для лечения герпеса. Страховая компания не может отказать в покрытии Вашего случая заболевания на основании «высоты титров» — просто никто им этого профессионально не объяснил. По поводу дисплазии и эрозии необходимо сдать бакпосевы из уретры, влагалища и цервикального канала. Как правило, их развитие связано не с вирусами герпеса и ВПЧ (хорошо, что у Вас не «нашли» и не лечили еще и это), а с урогенитальным дисбактериозом: неспецифическая бактериальная инфекция, не относящаяся к ЗППП. Лечение дисбактериоза – без применения антибиотиков.

Запитання 79. Доброго дня! Скажіть, будь-ласка, що собою являє вірус EBV (виявлено молекулярно-генетичним дослідженням по крові) і як він лікується. СMV i HSV-2 не виявлено ні по крові, ні по шкрібку. За останні 1,5 року було 2 викидні. Чи міг бути цей EBV їх причиною? Наперед, дуже вдячна

Ответ 79. Добрый день! EBV (4-й герпесвирус) достаточно часто является причиной выкидышей и других проблемных беременностей. Однако обнаружение EBV в крови – очень большая редкость. Тем более, что женщина, потерявшая беременность, обычно сама остается здоровой, ей этот вирус не угрожает и ее лечить от этого вируса не нужно. Поэтому вне беременности вирус обычно находится в латентной форме и его обнаружение в крови – скорее ошибка, чем установленный факт. Этот анализ необходимо повторить в другой лаборатории. Кроме того, на весь период беременности необходимо проводить ПЦР-мониторинг (5-7 раз) за всеми хроническими герпесвирусами. Неактивные до беременности они могут активизироваться во время беременности. И тогда необходимо проводить вируснейтрализующую терапию для предупреждения нового выкидыша или заражения плода.

Вопрос 80. Добрый день! Я уже задавала вопрос по поводу краснухи. Съездила и получила такой же ответ. Не подумайте, что я не доверяю вашей консультации, просто мне для врача нужна была бумажка. Ваши консультации даже гораздо ценнее! Так вот! Меня на счет краснухи тоже успокоили, но сказали что показатель по герпесу большой — 69,0. И по цитомегаловирусу — 10,0. Написано, что положительно, если более 10. Но назначили профилактику. Пить две недели витамин Е, протефлазид и гевиран (в дозировке 800 мг в сутки). Витамин Е пью, протефлазид тоже, так как вроде противопоказаний по беременности нет. А вот гевиран очень насторожил. В инструкции написано, что он способен проникать через плаценту и что пить его можно при беременности, если польза для матери превышает вред для ребенка. Я побоялась его пить, да и стоит ли, так как протефлазид тоже противогерпесный. Что вы посоветуете по препарату и по самому анализу? Через 2 недели надо сдать контрольныйанализ?

Ответ 80. Добрый день! Должен Вас огорчить. 1) Результаты Ваших анализов по ВПГ и ЦМВ вообще не являются поводом для какого-либо лечения. 2) Все назначенные препараты, когда действительно существует угроза инфицирования плода этими вирусами, совершенно неэффективны. 3) Активность, опасность для плода этих вирусов и, соответственно, показания для лечения проверяют методом ПЦР на ДНК ВПГ в крови, а ЦМВ – с крови, слюне и моче. Кроме того, необходимо пройти полное обследование на вирус Эпшетйна-Барр – 4-й герпесвирус. ПЦР-мониторинг активность хронических герпесвирусов необходимо проводить в определенные сроки на протяжении всей беременности.

Цитомегаловирусная инфекция у новорожденных: диагностика и лечение | #03/06

Цитомегаловирусная инфекция (ЦМВИ) относится к числу хрестоматийно латентных. Цитомегаловирус (ЦМВ) содержит ДНК, обладает способностью реактивироваться, тропностью к железистой ткани, где персистирует, оказывает цитопатическое действие, в результате которого образуются гигантские клетки, похожие на «совиный глаз».

В Западной Европе (Франция, ФРГ, Испания) от 50 до 70 % всего населения инфицированы ЦМВ. Точных статистических данных частоты распространения инфицированности по России и даже по Москве нет.

Большой толчок для изучения ЦМВИ дали успехи трансплантологии. Есть веские основания полагать, что причиной отторжения трансплантата является активация ЦМВИ. Частота инфицирования (наличие антител класса иммуноглобулина (Ig) G к ЦМВ) ЦМВ зависит от социально-экономических условий, степени повреждения иммунной системы и др. ЦМВ относятся к разряду «слабых антигенов». Изучение этих вирусов, их воздействия, например, на эндотелий сосудов, ряд других органов, кроме слюнных желез, продолжается.

Нами проводились многолетние систематические исследования (И. В. Орловская, А. В. Александровский, В. В. Зубков) различных аспектов развития этой инфекции. Было установлено, что это типичная социально значимая инфекция. Данные свидетельствуют о том, что в Москве за последние 15 лет ЦМВИ претерпела существенную эволюцию.

Так с 1988 по 1993 г. антитела класса IgG к ЦМВ у матерей и их новорожденных больных детей выявлялись лишь в 40–50 % случаев.

Выявлена зависимость от социальной принадлежности пациентов и ряда дополнительных факторов: наиболее часто (от 86 до 96 % случаев) инфекция выявляется у больных, перенесших пересадку почек, гомосексуалистов и больных СПИДом (Западная Европа, США).

По нашим данным, полученным на основании сероэпидемиологических исследований, проводившихся в 1995–1999 гг. и в 2000–2002 гг. у женщин репродуктивного возраста, родивших детей с внутриутробной инфекцией, частота циркуляции антител к ЦМВ класса IgG достигает высокого уровня (90 % от общего числа обследуемых) и не имеет тенденции к снижению.

Это свидетельствует об отсутствии и неэффективности контроля за инфекциями у женщин, передающимися половым путем, в том числе ЦМВИ. Установлено, что в 60 % случаев у больных имеются одновременно специфические антитела к нескольким перинатальным патогенам. Наиболее распространенными являются вирус простого герпеса (ВПГ), ЦМВ, хламидии и уреаплазма. Доля смешанных инфекций значительна и продолжает расти. Выявить лидирующего возбудителя сложно, это требует дополнительных исследований.

ЦМВИ — это инфекция плода. Эта инфекция особенно опасна для беременных женщин. Проявления ЦМВИ большей частью стертые, особенно часто у беременных женщин она протекает в виде острой респираторно-вирусной инфекции.

ЦМВИ после пубертатного периода распространяется в основном половым путем. У беременных женщин она проявляется чаще «под маской» другого заболевания. Поэтому своевременная диагностика заболевания затруднена. Специфически не проявляясь у женщины, у плода ЦМВИ вызывает врожденные нарушения центральной нервной системы, пороки развития сердца, почек.

Доказано, что ЦМВ являются причиной многоводия и одновременно развития водянки плода (A. Breinl, Lebmanu), угрозы и спонтанного прерывания беременности, фетоплацентарной недостаточности. Выявление ЦМВ у мертворожденных варьирует от 9 до 33 % (ФРГ, Франция). Инфекцию трудно выявить из-за несовершенства диагностики. Все проявления ЦМВИ у женщин и у плода развиваются на фоне иммунодефицита.

Одним из главных способов распространения инфекции является половой путь передачи. Об этом свидетельствует одновременное наличие у больных антител к ВПГ и ЦМВ.

Большое число беременных женщин, особенно в последних триместрах беременности, заражаются при орогенитальных контактах (до 20 % и более).

Заражение ЦМВИ может происходить после трансфузий инфицированной крови. В Западной Европе и США 15–70 % образцов крови содержат ЦМВ. Кроме того, проникновение в организм ЦМВ может иметь место при трансплантации инфицированных почек, костного мозга, сердца и других органов. В 20 % случаев причина реакции отторжения — активация ЦМВ (ФРГ, США). Несовершенство диагностики ЦМВИ зачастую не позволяет доказать значимость вирусной агрессии при формировании того или иного патологического процесса.

Как было сказано выше, все проявления ЦМВИ у женщин и плода развиваются на фоне иммунодефицита. Результаты многолетних исследований, проведенных в НЦАГиП РАМН, показали, что одной из ведущих причин реализации внутриутробной инфекции является состояние иммуносупрессии у матери в период беременности. Особенно четко это проявляется у женщин с гиперандрогенией, миастенией, лимфогранулематозом и др., которые получают стероидную терапию до и во время беременности.

ЦМВИ является эндемичной во всех популяциях человека. Пути заражения плода, новорожденного, взрослого человека различны.

Заражение плода может осуществляться гематогенно-трансплацентарным путем, особенно при наличии первичной инфекции у женщины и при повреждении плаценты с нарушением ее барьерной функции. В 10–15 % случаев у плода признаки ЦМВИ проявляются сразу после рождения. Гематогенно-трансплацентарный путь инфицирования плода ЦМВ является основным.

Восходящим путем заражение происходит при наличии ЦМВ в цервикальном и вагинальном секретах, а также через инфицированные околоплодные воды.

Интранатально заражаются до 5–7 % новорожденных, как путем непосредственного контакта с инфицированным материалом, так и при аспирации околоплодных вод, содержащих ЦМВ.

В постнатальном периоде новорожденный заражается в 30 % случаев (данные ВОЗ) от выделений матери, содержащих вирус: слюну, мочу, выделений из гениталий, грудное молоко, кровь. Наши исследования показали, что антиген ЦМВ можно выявить и в ликворе, особенно при наличии у ребенка генерализованной формы инфекции с церебральными повреждениями.

По данным Clive Smeet, гематогенным путем ЦМВ распространяется в различные органы, включая почки, печень, селезенку, сердце, мозг, сетчатку глаза, пищевод, внутреннее ухо, легкие, кишечник.

В период вирусемии ДНК ЦМВ можно обнаружить в моноцитах, лимфоцитах, нейтрофилах. Лейкоциты играют важную роль в диссеминации вируса по всему организму. ЦМВ более тропен к полинуклеарным фагоцитам, чем к мононуклеарным клеткам. Можно считать доказанным факт поражения эндотелия сосудов, сердца, желудочков мозга.

ЦМВИ может протекать в виде первичной (острой) инфекции с появлением и ростом специфических антител к ЦМВ класса IgM, а в дальнейшем и IgG. Эта форма инфекции характеризуется наличием вирусоспецифического антигена в крови, моче и ликворе. Первичная инфекция у беременных женщин особенно опасна. В этом случае очень легко происходит вертикальная трансмиссия (трансплацентарным путем) вируса плоду.

Эта инфекция может вызвать серьезные изменения у плода: микроцефалию, гепатоспленомегалию, тромбоцитопению, затянувшуюся желтуху, реже — потерю слуха, умственную отсталость и др. В этой ситуации у плода могут возникать вирусный интерстициальный пневмонит, ретинит, энцефалит, болезни желудочно-кишечного тракта.

При более раннем заражении ЦМВ могут иметь место пороки развития желудочно-кишечного тракта. Заражение плода при первичной инфекции во всех случаях происходит при отсутствии у беременной специфических IgG-антител, что является причиной тяжелого поражения плода.

Первичной формой ЦМВИ беременные женщины часто заражаются в результате орогенитальных контактов. Эта форма инфекции представляет наибольшую опасность для беременной женщины и плода, так как она развивается на фоне полного отсутствия специфических антител.

Под реактивацией понимают форму ЦМВИ, которая ранее протекала латентно, бессимптомно. Реактивация вируса происходит под влиянием терапии стероидными гормонами у беременных женщин (плода), иммуноскомпрометированных больных (реципиентов трансплантатов, лиц больных СПИДом). Так, у новорожденных, родившихся от женщин, в отношении которых применялись репродуктивные технологии, а также у самих женщин нами в 100 % случаев были выявлены антицитомегаловирусные IgG-антитела.

При реактивации ЦМВИ у беременной женщины может происходить подъем титров антител как класса IgG, так и IgM к ЦМВ. Однако у ряда пациентов нового появления антител IgM не происходит в связи с формированием вторичного иммунологического ответа, характеризующегося гиперпродукцией специфических IgG-антител. Именно этим объясняется то обстоятельство, что в этом случае может родиться как здоровый ребенок, так и новорожденный с серьезными проявлениями ЦМВИ.

ЦМВИ (первичная) может переходить в хроническую или латентную формы, которые могут реактивироваться.

Реинфекция — заражение пациента новым экзогенным вирусом — может сопровождаться иммунологическими сдвигами, повторным нарастанием титра специфических IgM, а в дальнейшем и IgG или (реже) только повышением титра специфических антител класса IgG. Серологических тестов, помогающих отличить первичную инфекцию от вторичной в таких ситуациях не существует.

У больных с иммунодефицитом, СПИДом и у новорожденных детей антитела при реактивации могут не выявляться. У них в процессе диагностики должно использоваться одновременно несколько методов.

Одновременного наличия антител класса IgG и положительного анализа (полимеразная цепная реакция — ПЦР) достаточно для подтверждения клинического диагноза.

По клиническим проявлениям врожденная ЦМВ и герпетическая инфекции имеют как сходные черты, так и значимые различия. Оба заболевания имеют склонность к хронизации процесса.

Частота внутриутробных повреждений различных органов и систем ЦМВ, по данным различных авторов, не одинакова. По уточненным патогистологическим данным, наиболее часто наблюдаются (в порядке их частоты выявления) поражения мозга (менингоэнцефалит, поражения желудочков мозга, кальцификаты, «кальцинация» мозговых сосудов). Все эти морфологические изменения сопровождаются различными неврологическими проявлениями: от легких церебральных изменений до серьезного судорожного, гипертензионно-гидроцефального синдромов и др.

Одним из распространенных проявлений ЦМВИ является блокада ликвороносных путей (до 7 % из числа перинатальных повреждений мозга вирусной этиологии). Другой «точкой приложения» ЦМВ часто является сосудистое сплетение с последующим образованием кист.

Наши наблюдения показали, что минерализационная васкулопатия («кальцификация» — по терминологии зарубежных авторов) мозговых сосудов, сопровождающая ЦМВИ, может быть причиной судорожного синдрома у новорожденного. Судорожный синдром в этом случае возникает с первых часов после родов и продолжается до 5 дней и больше. Это состояние требует тщательного специфического лечения цитотектом, антиконвульсантами и др. Изменения сосудов мозга, вызываемые ЦМВ, требуют дальнейшего изучения.

В этих случаях требуется исключить герпетическую инфекцию новорожденного ребенка. Внутриутробная гидроцефалия у плода часто связывается с ЦМВ (ФРГ, Австрия).

Довольно распространенным проявлением ЦМВИ является пневмония. Среди общего числа пневмоний (больше 1/3 всех больных, поступающих в отделение патологии новорожденных НЦАГиП) примерно в 10 % случаев этиологическим фактором является ЦМВ, что подтверждено при оценке эпидемиологического анамнеза матери: наличие эндоцервицита, кольпита, иммуносупрессивных факторов, носительство ВПГ и ЦМВ, а также обязательное наличие IgG и IgM и (реже) — положительная ПЦР у новорожденного.

Следует заметить, что рентгенологически при этом определялись очаговые воспалительные инфильтраты, реже — сегментарные тени. При гематологическом исследовании выявлялись лейкоцитоз с нейтрофильным сдвигом влево, реже — тромбоцитопения. Нет сомнения, что в генезе этих пневмоний участвует вторичная бактериальная флора, активация последней наступает позже. Заражение новорожденного в этом случае происходит как аспирационным (чаще), так и гематогенным путем. Вторичный иммунодефицит в этих случаях приводит к более длительному течению заболевания и требует одновременного проведения иммунотерапии.

Как указывают J. Frank и H. Fridman, ЦМВИ в виде пневмонии часто приводит к смертельным исходам у больных СПИДом, у пациентов после трансплантации почек и костного мозга, сердца. Причина тяжелого течения пневмонии при ЦМВИ — угнетение иммунных реакций.

Нередко проявлением ЦМВИ у новорожденных являются гепатоспленомегалия, затянувшаяся желтуха (до 32%). За последние 5 лет повысилось число больных с гипербилирубинемией, с незначительным изменением уровня трансаминаз. Этот факт требует дальнейшего изучения вопроса о роли ЦМВ.

Тромбоцитопения нами отмечалась (до 2–3 %) в основном на фоне генерализованных форм инфекции.

В 30 % случаев ЦМВИ может протекать без локальных изменений и проявляться только ухудшением общего состояния пациентов, наличием специфических антител IgM. Эта форма в ряде случаев протекает легко, но всегда требует исключения генерализации процесса, проведения иммунотерапии.

ЦМВИ может служить причиной: миокардитов, кардиомегалии, утолщения миокарда, увеличения предсердия, гидроперикарда (до 15 %), а также водянки плода.

В отдельных случаях могут отмечаться и поздние поражения, которые регистрируются только в 6–7 мес жизни: слепота, глухота, отставание в развитии и др.

Диагностика этой инфекции сложна и должна проводиться с учетом ее клинических проявлений.

  • Оценка эпиданамнеза матери (вирусоносительство), наличие у нее эндоцервицита, аднексита, кольпита, наличие возможных иммуносупрессивных воздействий на нее и на плод, обследование пациентки.
  • Учет соответствующей клиники у ребенка: наличие кальцификатов в мозгу, васкулопатии сосудов мозга, вентрикуломегалии, энцефалита, а также выявление пневмонии, гепатоспленомегалии, затянувшейся гипербилирубинемии и др.
  • Эхоэнцефалография и УЗИ внутренних органов.
  • Определение антител классов IgM и IgG к ЦМВ (метод иммуноферментного анализа — ИФА). Классический метод с использованием детекции нарастания в 4 и более раз специфических IgG-антител вначале и спустя 12–14 дней у новорожденных не применяется, хотя у взрослых он является наиболее достоверным и точным. У беременных этот серологический метод вполне может быть использован. Иммунная система новорожденного не способна синтезировать антитела класса IgG; последние переходят трансплацентарно от матери плоду.
  • Выявление вирус-специфических антигенов (частей вирусов) в культуре клеток не применяется даже для научных целей из-за дороговизны методики. Вирус-специфический антиген можно выявить путем экспресс-метода иммунофлюоресценции; последний является точным, но, к сожалению, в последние годы почти не используется.

Широко применяются биотехнологические методы: ДНК-гибридизации и особенно ПЦР. Однако гибридизационная техника требует совершенствования, наличия качественных тест-систем и квалифицированных лаборантов.

Метод ПЦР, к сожалению, возложенных на него надежд не оправдал. По нашим данным, подтвердить диагноз этим методом можно не больше чем в 50 % случаев. Хотя за рубежом (ФРГ) многие авторы считают, что положительной ПЦР и наличия специфических IgG-антител достаточно для окончательной постановки диагноза.

Во всех случаях при выявлении антигена ЦМВ в моче, крови, ликворе новорожденного, в том числе при положительной ПЦР необходимо подтвердить инфицирование выявлением специфических противовирусных антител (IgG и IgM).

Следует упомянуть, что определение наличия в крови IgM-специфических антител является наиболее надежным и быстрым методом диагностики.

  • Для выявления антигена применяются электронная микроскопия (ФРГ) и иммуногистология.
  • Окончательная интерпретация иммуновирусологических результатов должна осуществляться с одновременной оценкой эпиданамнеза матери, возможных иммуносупрессивных воздействий на нее, особенно при использовании репродуктивных технологий с учетом клинических проявлений инфекции у ребенка.

Большое научно-практическое значение имеют результаты проводившихся недавно исследований по выяснению защитной роли специфических противовирусных IgG к антигенам ЦМВ, передающихся трансплацентарно от матери плоду.

Исследования, проводимые одновременно в лабораториях трех институтов (НЦАГиП, НИИ вирусных препаратов им. О. Г. Анджапаридзе, ГНИИ биологического приборостроения), дали возможность сделать следующие научно-практические выводы.

  • В основе развития внутриутробной инфекции лежат иммуносупрессивные факторы, влияющие на состояние матери, плода и новорожденного — развитие у них вторичных иммунодефицитных состояний. Уникальным аргументом в пользу защитной роли специфических противовирусных иммуноглобулинов является тот факт, что больные новорожденные, родившиеся от матерей с первичной формой генитального герпеса (при отсутствии у них антител), заражаются в 10 раз чаще. Инфекционный процесс у них в 86 % случаев протекает в тяжелой генерализованной форме (с повреждениями мозга, пневмониями и др.) и часто заканчивается летально.

Установлено, что в 12 % случаев специфические противовирусные антитела от больной матери новорожденному передаются не полностью. Очевидно, что причина этого явления — нарушение функции плаценты вследствие развития в ней инфекционного процесса.

Убедительно показана роль угнетения иммунологических факторов в генезе реактивации ЦМВ и возникновении инфекции у новорожденных.

Дефицит противовирусных IgG у плода и новорожденного приводит к диссеминации вируса, развитию генерализованной формы инфекции и к тяжелому повреждению мозга, легких, надпочечников и др.

Отмечаются повреждения клеточного звена иммунитета; при этом реальная возможность их компенсации уменьшается. Выявлен дефицит клеток, принадлежащих к субпопуляции Т-клеток, обладающих цитотоксической активностью против клеток, инфицированных вирусами.

  • Углубленные исследования противовирусного иммунитета дали возможность выявить группу новорожденных, больных внутриутробной инфекцией, с «транзиторными иммуносупрессивными состояниями», в терапии которых следует использовать препараты, воздействующие на гуморальное звено иммунитета.
  • Нарушения в гуморальном звене иммунитета компенсируются внутривенным введением препаратов иммуноглобулина. Разработана специальная технология их применения. Для больных с внутриутробными вирусными инфекциями эти препараты являются средством как заместительной, так и специфической терапии из-за содержания в них противовирусных антител. Существуют убедительные доказательства их позитивной роли. Применение иммуноглобулинов способствует не только улучшению состояния больных, но и повышению в их крови содержания IgG. Из-за наличия в препаратах иммуноглобулинов антител различной специфичности одновременное их введение с зовираксом и антибиотиками обеспечивает их синергидное действие.

Это дает возможность создать необходимый компонент «терапевтической технологии» — иммунотерапию.

Способы терапии ЦМВИ: химиотерапия (ганцикловир, фоскарнет), интерферонотерапия (достоверных сведений о действии на ЦМВ нет) и иммунотерапия специфическим антицитомегаловирусным иммуноглобулином (цитотект).

Ганцикловир (цимевен) — противовирусный препарат, сходный с ацикловиром, оказывает воздействие на все виды вируса герпеса. Ганцикловир в 50 раз превосходит ацикловир по эффективности воздействия на ЦМВ.

Препарат был синтезирован в 1982 г. Он угнетает репликацию вируса за счет конкурентного ингибирования вирусной ДНК-полимеразы и нарушения удлинения цепи ДНК. Ганцикловир выводится из организма через почки. По данным вирусологических исследований, применение ганцикловира приводит к подавлению вируса у 87 % больных, отмечается исчезновение ЦМВ в крови и моче. Ганцикловир применялся в основном в США у больных ретинитом, пневмонией, которые развились у пациентов, страдающих СПИДом; у реципиентов костного мозга, почек, а также у лиц с цитомегаловирусным колитом. Препарат используется в дозе 10–20 мг/кг в неделю внутривенно. Во всех случаях была доказана его клиническая и вирусологическая эффективность.

После лечения ганцикловиром, однако, отмечались и осложнения в виде нейтропении, тромбоцитопении. По этой причине мы отказались от применения ганцикловира.

Таким образом, можно отметить, что химиотерапия ЦМВИ делает лишь первые шаги. В этом направлении необходимы дальнейшие исследования.

Фоскарнет, применявшийся у больных с ЦМВ-пневмонией, нефротоксичен. Поиски эффективных и безопасных противовирусных препаратов продолжаются.

В настоящее время единственным действенным методом терапии и неотложной профилактики ЦМВИ у новорожденных является использование иммуноглобулина для внутривенных вливаний, содержащего антитела класса IgG к ЦМВ.

Имеются веские научные доводы в пользу данного лечебного подхода. Во-первых, существуют обширные научно-практические доказательства эффективности применения иммуноглобулинов при инфекциях; во-вторых, не вызывает сомнений необходимость коррекции гуморального звена иммунитета, особенно при вторичных иммунодефицитах. Таким образом, при ЦМВИ иммуноглобулины являются средством как иммунозаместительной, так и этиотропной терапии. В-третьих, в последние годы доказано модулирующее влияние иммуноглобулинов при внутривенном введении на клеточное звено иммунитета. В-четвертых, активация ЦМВИ происходит всегда на фоне иммунодефицитов. Введение антицитомегаловирусных иммуноглобулинов воздействует не только на этиологический фактор, но и дает возможность влиять на различные патогенетические звенья заболевания.

Показано, что клеточный иммунный ответ у пациентов, инфицированных ЦМВ, «распознает» минимум один протеин «очень ранней» вирусной репликационной фазы на поверхности инфицированной клетки. Это приводит к разрушению инфицированной клетки вирусоспецифическими цитотоксическими Т-лимфоцитами. У пациентов с иммунодефицитом это невозможно, так как вирусоспецифических цитотоксических Т-лимфоцитов у них нет, или их количество недостаточно. ЦМВ-нейтрализующие антитела являются в этом случае единственными иммунологическими компонентами, которые предотвращают инфицирование клетки.

Механизмы воздействия иммуноглобулинов и синтетических вирусостатиков различаются, так как последние не могут проникать в клетку. Противовирусное действие развивается вне клетки. В результате связывания с гликопротеинами на поверхности вируса иммуноглобулины предотвращают инфицирование других клеток-хозяев. Нейтрализован может быть как свободный вирус, так и вирус во время выхождения из инфицированной клетки после репликации. Свободные, нейтрализованные вирусы выводятся почками. Если для терапии и профилактики ЦМВИ у пациентов с подавленным иммунитетом применяют препараты человеческого иммуноглобулина, то выраженных побочных эффектов не возникает, в отличие от терапии вирусостатиками.

Одним из препаратов, используемых для терапии серьезных форм ЦМВИ у беременных и новорожденных, является цитотект. С началом его применения активизировалась разработка новых методов диагностики этой инфекции.

Цитотект представляет собой гипериммунный иммуноглобулин для внутривенных вливаний, содержащий в 10 раз больше антител к ЦМВ, чем обычные иммуноглобулины. Препарат готовится из крови специально отобранных доноров, которые имеют высокий титр противоцитомегаловирусных антител. В 1 мл цитотекта содержится не менее 50 единиц антител против ЦМВ (единицы эталонного препарата Института Пауля Эрлиха). Иммуноглобулин соответствует евростандарту качества. Контроль за содержанием антител осуществляет Федеральное ведомство по вакцинам и сывороткам Германии (Paul Ehrliсh Institut). Одновременно в препарате содержится повышенный титр антител к антигенам вируса Эпштейн–Барр и к антигену ВПГ 1-го и 2-го типа. Кроме того, в цитотект входит широкий спектр антител к микробным возбудителям — перинатальным патогенам, вызывающим серьезные инфекции у новорожденных и женщин в послеродовом периоде. Эти антитела усиливают опсонизацию микроорганизмов, имеют близкое к физиологической норме распределение субклассов IgG (IgGI — IgGIV).

Производство цитотекта контролируется в соответствии со стандартами, разработанными Институтом Пауля Эрлиха. Забор плазмы проводится после тщательного отбора и тестирования доноров.

Кроме того, под контролем находится весь пул плазмы. Многоступенчатая подготовка, проверка безопасности цитотекта исключает передачу гепатитов и других инфекций, включая пока еще не идентифицированные.

Нами проводилось клинико-иммунологическое изучение цитотекта (Н. И. Кудашов, О. В. Орловская) у 56 больных с ЦМВИ. Диагноз был подтвержден во всех случаях путем выявления у больного антицитомегаловирусных IgM.

Одновременно в препаратах, вводимых детям, определялось наличие не только антител IgG к ЦМВ, но и к ВПГ. Было установлено, что во всех сериях используемых препаратов содержались специфические антитела к антигенам ЦМВ и ВПГ 1-го типа, при этом антител к ВПГ 2-го типа содержалось в 2 раза меньше. Было убедительно доказано, что цитотект оказывает в комплексе с традиционной терапией выраженный клинико-иммунологический эффект. Происходило не только улучшение общего состояния больных: через 7–8 дней IgM исчезал из крови пациентов, кроме того, существенно повышалось содержание в крови противоцитомегаловирусных IgG, одновременно повышалось и содержание противогерпетических IgG. Таким образом, цитотект является практически единственным препаратом, который эффективен в борьбе с ЦМВИ.

Показания для применения цитотекта в ранние сроки беременности:

  • первичная инфекция у беременной: циркуляция в крови антител к ЦМВ класса IgM;
  • высокая степень вероятности трансмиссии вируса плоду. Дозы: на 28-й неделе — 2 мл/кг веса, на 31-й неделе — 1 мл/кг;
  • у беременных-носительниц антител к ЦМВ класса IgG при многократных перинатальных потерях, особенно при сочетании с состояниями, сопровождающимися иммуносупрессией (гиперандрогения, миастения, использование репродуктивных технологий).

Цитотект вводится сразу же после родов матери и ребенку в следующих случаях:

  • при первичной (острой) ЦМВИ у матери (циркуляция антител IgM в крови) в связи с высокой вероятностью передачи вируса плоду;
  • при рецидиве инфекции (наличие антител IgG + симптомы инфекции) в конце беременности;
  • матери с наличием антицитомегаловирусных антител IgG и ее ребенку (6–7 мес) при повышении у них титра антител в процессе наблюдения.

Дозы цитотекта для профилактики и терапии ЦМВИ для новорожденных — 2–4 мл/кг массы тела, при наличии энцефалита и серьезных невротических изменений введение повторяется многократно.

Для матерей с терапевтической целью используют следующие схемы лечения цитотектом:

  • в легких случаях — в дозе 2 мл/кг массы тела, трансфузия цитотекта может быть повторена через 4 дня в зависимости от клинической картины;
  • в тяжелых случаях — в дозе 4 мл/кг массы тела, трансфузия препарата может быть повторена через 4 дня, при ухудшении состояния возможно повторное многократное введение препарата.

С профилактической целью — в дозе 1 мл/кг массы тела. Препарат вводится только внутривенно, капельно (20 капель в 1 мин).

Дозы цитотекта для профилактики и терапии ЦМВИ у новорожденных составляют 2–4 мл/кг массы тела.

Постоянным компонентом лечения ЦМВИ у новорожденных является антибиотикотерапия. В этиологическом отношении почти все инфекционные болезни у новорожденных вызываются смешанной вирусно-бактериальной флорой. При ЦМВИ, особенно при наличии пневмонии, активация вторичной бактериальной флоры происходит очень быстро — с первых дней. Выбор антибактериальных препаратов производится эмпирически и основывается на большом опыте и знании спектра возможных возбудителей и особенностей действия антибиотика. Для эмпирической стартовой терапии целесообразно выбирать антибиотик с широким спектром бактерицидного действия, при генерализованной форме инфекции используется комбинированная антибактериальная терапия препаратами, обладающими активностью в отношении возможных в данном случае «перинатальных патогенов».

Одним из наиболее часто применяемых в последние годы антибиотиков является сульперазон. Он представляет собой комбинацию цефоперазона с ингибитором β-лактамаз сульбактамом (цефалоспорины 3-го поколения). Сульперазон используется внутривенно (в первые 3–4 дня) и внутримышечно дважды в день в дозе 80–100 мг/кг массы тела; курс терапии от 8 до 14 дней, в среднем — 10 дней.

Для усиления грамотрицательного действия сульперазона применяется обычно аминогликозид — нетромицин. Препарат назначался из расчета 7 мг/кг массы тела в сутки; курс терапии — не более 7 дней. Иммуноглобулины для внутривенного вливания и антибиотики (сульперазон + нетромицин) входят в стандарт терапии. Они являются эффективными, существенно сокращают длительность пребывания ребенка в стационаре (до 10–12 дней). Кроме того, следует отметить отсутствие внутрибольничных инфекций, рецидивов и случаев заболевания после выписки в домашних условиях.


Н. И. Кудашов, доктор медицинских наук, профессор
НЦАГиП, Москва

Цитомегаловирусная инфекция — симптомы болезни, профилактика и лечение Цитомегаловирусной инфекции, причины заболевания и его диагностика на EUROLAB

Что такое Цитомегаловирусная инфекция —

Цитомегаловирусная инфекция (Human Cytomegalovirus Infection, ЦМВ-инфекция, цитомегалия, вирусная болезнь слюнных желез, инклюзионная цитомегалия, болезнь с включениями) — антропонозная оппортунистическая инфекция, протекающая обычно латентно или легко. Представляет опасность при различных иммунодефицитных состояниях и беременности (вслед¬ствие риска внутриутробного заражения плода).

Ещё в 1882 г. немецкий патологоанатом X. Рибберт обнаружил в почечных канальцах мертворождённого ребёнка своеобразные гигантские клетки с включениями в ядре. Впоследствии они получили название цитомегалических клеток (Гудпасчер Э., Тэлбот Ф., 1921). Позднее Л. Смит и У. Роу (1956) выделили вирус, вызывающий заболевание с развитием характерной цитомегалии. Он был назван цитомегаловирусом (ЦМВ), а само заболевание — цитомегаловирусной инфекцией.

Что провоцирует / Причины Цитомегаловирусной инфекции:

Возбудитель цитомегаловирусной инфекции— ДНК-геномный вирус рода Cytomegalovirus (Cytomegalovirus hominis) подсемейства Веtaherpesvirinae семейства Herpesviridae. Известно 3 штамма вируса: Davis, AD-169 и Kerr. Медленная репродукция вируса в клетке возможна без её повреждения. Вирус инактивируется при нагревании и замораживании, хорошо сохраняется при комнатной температуре. При — 90 °С сохраняется длительное время, сравнительно стабилен при рН 5,0-9,0 и быстро разрушается при рН 3,0.

Резервуар и источник инфекции — человек с острой или латентной формой заболевания. Вирус может находиться в различных биологических секретах: слюне, отделяемом носоглотки, слезах, моче, испражнениях, семенной жидкости, секрете шейки матки.

Механизмы передачи многообразны, пути передачи — воздушно-капельный, контактный (прямой и опосредованный — через предметы обихода) и трансплацентарный. Возможно заражение половым путём, при пересадке внутренних органов (почек или сердца) и переливании крови инфицированного донора. Интранатальное заражение ребёнка наблюдают гораздо чаще трансплацентарного. Наиболее опасно для плода инфицирование матери в I триместр беременности. В подобных ситуациях наиболее велика частота нарушений внутриутробного развития.

Естественная восприимчивость людей высокая, но широко распространена латентная инфекция. Клинические проявления инфекции, относимой к оппортунистическим заболеваниям, возможны в условиях первичного или вторичного иммунодефицита.

Основные эпидемиологические признаки цитомегаловирусной инфекции. Болезнь регистрируют повсеместно, о её широком распространении свидетельствуют противовирусные антитела, выявляемые у 50-80% взрослых. Многообразие путей заражения ЦМВ и полиморфность клинической картины определяют эпидемиологическую и социальную значимость ЦМВ-инфекции. Это заболевание играет важную роль в трансплантологии, гемотрансфузиологии, перинатальной патологии, может быть причиной недоношенности, мертворождений, врождённых дефектов развития. У взрослых ЦМВ-инфекцию встречают как сопутствующее заболевание при различных иммунодефицитных состояниях. Продолжающееся загрязнение окружающей среды, применение цитостатиков и иммунодепрессантов способствуют росту частоты ЦМВ-инфекции. В последние годы особенно актуальным стало её обострение у ВИЧ-инфицированных. У беременных с латентной ЦМВ-инфекцией поражение плода происходит далеко не всегда. Вероятность внутриутробного заражения значительно выше при первичном инфицировании женщины во время беременности. Сезонных или профессиональных особенностей заболеваемости не выявлено.

Патогенез (что происходит?) во время Цитомегаловирусной инфекции:

При различных путях передачи воротами инфекции могут быть слизистые оболочки верхних дыхательных путей, ЖКТ или половых органов. Вирус проникает в кровь; кратковременная вирусемия быстро завершается локализацией возбудителя при внедрении в лейкоциты и мононуклеарные фагоциты, где происходит его репликация. Инфицированные клетки увеличиваются в размерах (цитомегалия), приобретают типичную морфологию с ядерными включениями, представляющими собой скопления вируса. Образование цитомегалических клеток сопровождается интерстициальной лимфогистиоцитарной инфильтрацией, развитием узелковых инфильтратов, кальцификатов и фиброза в различных органах, железистоподобных структур в головном мозге.

Вирус способен длительно и латентно персистировать в органах, богатых лимфоидной тканью, будучи защищенным от воздействия антител и интерферона. В то же время он может подавлять клеточный иммунитет прямым воздействием на Т-лимфоциты. При различных иммунодефицитных состояниях (в раннем детском возрасте, при беременности, применении цитостатиков и иммунодепрессантов, ВИЧ-инфекции) и прежде всего при нарушениях клеточного иммунитета, дополнительно усугублённых прямым воздействием вируса, возможны реактивация возбудителя и его гематогенная генерализация с поражением практически всех органов и систем. При этом большое значение имеет эпителиотропность вируса. Она особенно выражена по отношению к эпителию слюнных желёз, под воздействием вируса превращающемуся в цитомегалические клетки.

Активную ЦМВ-инфекцию рассматривают как индикатор дефектов клеточного иммунитета, она включена в группу СПИД-ассоциированных состояний.

Симптомы Цитомегаловирусной инфекции:

Международная классификация болезней Х пересмотра
International Statistical Classification of Diseases and Related Health Problems 10th Revision Version for 2006 не относит цитомегаловирусную инфекцию к инфекциям, передающихся половым путем и различает следующие заболевания, связанные с ЦМВ.
B25.0 Цитомегаловирусная болезнь
B25.0 Цитомегаловирусный пневмонит
B25.1 Цитомегаловирусный гепатит
B25.2 Цитомегаловирусный панкреатит
B25.8 Другие болезни,вызванные цитомегаловирусом
B25.9 Цитомегаловирусная болезнь неспецифическая
B27.1 Цитомегаловирусный мононуклеоз
P35.1 Врожденная цитомегаловирусная инфекция

Среди разнообразных вариантов течения ЦМВ-инфекции преобладают субклинические формы и латентное вирусоносительство. Клинически выраженной инфекция становится в условиях иммунодефицита. Единая клиническая классификация ЦМВ-инфекции не разработана. В соответствии с одной из классификаций, выделяют врождённую ЦМВ-инфекцию в острой и хронической формах и приобретённую ЦМВ-инфекцию в латентной, острой мононуклеозной или генерализованной формах.

Врождённая ЦМВ-инфекция. В большинстве случаев клинически не проявляется на ранних этапах жизни ребёнка, однако на более поздних стадиях его развития выявляют разнообразную патологию: глухоту, хориоретинит с атрофией зрительных нервов, снижение интеллекта, нарушения речи. Вместе с тем в 10-15% случаев при врождённой ЦМВ-инфекции развивается так называемый явный цитомегаловирусный синдром. Его проявления зависят от сроков заражения плода во время беременности.

Острая врождённая ЦМВ-инфекция.
На ранних сроках беременности приводит к внутриутробной гибели плода или рождению ребёнка с разнообразными пороками развития: микроцефалией, микро- и макрогирией, гипоплазией лёгких, атрезией пищевода, аномалиями строения почек, дефектами межпредсердной и межжелудочковой перегородок, сужением лёгочного ствола и аорты и т.д.

— При заражении плода в поздние сроки беременности пороки развития не формируются, однако у новорождённых с первых дней жизни выявляют признаки разнообразных заболеваний: геморрагический синдром, гемолитическую анемию, желтухи различного генеза (вследствие врождённого гепатита, цирроза печени, атрезии жёлчных путей). Возможны разнообразные клинические проявления, свидетельствующие о поражении различных органов и систем: интерстициальная пневмония, энтериты и колиты, поликистоз поджелудочной железы, нефрит, менингоэнцефалит, гидроцефалия.

Острая врождённая ЦМВ-инфекция при развитии явного цитомегаловирусного синдрома имеет склонность к генерализации, тяжёлому течению с присоединением вторичных инфекций. Часто неизбежен летальный исход в течение первых недель жизни ребёнка.

Хроническая врождённая ЦМВ-инфекция. Характерны микрогирия, гидроцефалия, микроцефалия, помутнение хрусталика и стекловидного тела.

Приобретённая ЦМВ-инфекция.
У взрослых и детей старшего возраста в большинстве случаев протекает латентно в виде бессимптомного носительства или субклинической формы с хроническим течением.

Острая форма приобретённой ЦМВ-инфекции. Часто может не иметь чёткой клинической симптоматики, иногда по основным клиническим проявлениям сходна с гриппом, инфекционным мононуклеозом или вирусным гепатитом.

У взрослых с иммунодефицитными состояниями различной выраженности (от физиологической иммуносупрессии при беременности до ВИЧ-инфекции), а также у детей до 3 лет реактивация ЦМВ проявляется в виде генерализованной формы с разнообразными поражениями органов и систем. В процесс могут быть вовлечены ЦНС, лёгкие, печень, почки, ЖКТ, мочеполовая система и т.д. Наиболее часто диагностируют гепатит, интерстициальную пневмонию, энтероколиты, воспалительные процессы различных отделов половых органов (чаще у женщин), энцефалиты. При полиорганных поражениях заболевание отличает тяжёлое течение, оно может принимать черты сепсиса. Исход часто неблагоприятный.

Могут развиться язвы пищевода, желудка, кишечника (толстого и тонкого). Язвы могут приводить к кровотечениям, при перфорации развивается перитонит. Нередко развивается цитомегаловирусный гепатит. У больных СПИДом цитомегаловирусная инфекция часто приводит к развитию хронического энцефалита или к появлению подострой энцефалопатии. Нарастает апатия и через несколько недель или месяцев переходит в деменцию. Вирус цитомегалии может обусловливать развитие ретинита, который приводит к слепоте больных СПИДом, а также лиц, перенесших операцию по трансплантации органов. На сетчатой оболочке появляются участки некроза, которые постепенно расширяются.

Поражения глаз необходимо дифференцировать от сходных изменений, которые наблюдаются при токсоплазмозе, кандидозе и герпетической инфекции.

Помимо ВИЧ-инфицированных цитомегаловирусная инфекция является важным патогенетическим фактором, осложняющим операции по трансплантации органов. При трансплантации почек, сердца, печени цитомегаловирус вызывает лихорадку, лейкопению, гепатит, пневмонию, колит, ретинит. Чаще всего это происходит в течение 1-4 мес после операции. Следует отметить, что при первичном ипфицировании осложнение протекает более тяжело, чем при активизации латентной цитомегаловирусной инфекции. Тяжесть течения и клинические проявления зависят и от степени иммунодепрессии и от используемых иммунодепрессантных препаратов.

Цитомегаловирусная пневмония развивается примерно у 20% больных; перенесших операцию по пересадке костного мозга. Смертность в этой группе больных равняется 88%. Максимальный риск развития болезни наблюдается с 5-й по 13-ю нед после трансплантации. Более тяжело цитомегалия протекает у лиц пожилого возраста. У лиц, перенесших трансплантацию почки, цитомегаловирусная инфекция может обусловить дисфункцию трансплантата.

Проявления цитомегаловирусной инфекции у беременных. У беременных ЦМВИ имеет различные клинические формы. При острой инфекции могут развиваться поражения печени, легких, мозга. Как правило, больные жалуются на общее недомогание, головную боль, утомляемость, слизистые выделения из носа, беловато-голубые выделения из гениталий, увеличение и болезненность подчелюстных слюнных желез. Некоторые характерные симптомы проявляются в комплексе: выраженный стойкий к проводимой терапии гипертонус тела матки, вагинит, кольпит, гипертрофия, кисты и преждевременное старение плаценты, многоводие. На этом фоне масса плода часто превышает гестационный возраст, а также наблюдается интимное прикрепление хориальной ткани плаценты, преждевременная отслойка нормально расположенной плаценты, кровопотеря в родах, достигающая 1% массы тела женщины, клиника скрытого послеродового эндометрита с развитием нарушений менструального цикла в дальнейшем.

Чаще всего цитомегаловирусная инфекция протекает в виде латентной инфекции с периодическими обострениями. При постановке диагноза решающее значение имеют результаты лабораторного обследования. Вспомогательную роль играет наличие отягощенного акушерского анамнеза, угроза прерывания предыдущей беременности, преждевременных родов, рождение больных детей, с пороками развития. У женщин с хронической ЦМВИ чаще отмечается псевдоэрозия шейки матки, эндометрит, дисфункция яичников, экстрагенитальные заболевания (гепатит, хронический холецистит, панкреатит, мочекаменная болезнь, хронический гайморит, пневмония, хронические заболевания подчелюстных и околоушных слюнных желез).

Любые проявления ЦМВ-инфекции рассматривают как индикаторные в отношении ВИЧ-инфекции. В этом случае необходимо обследование больного на антитела к ВИЧ.

Осложнения цитомегаловирусной инфекции
Осложнения разнообразны и зависят от клинических вариантов течения заболевания: интерстициальная или сегментарная пневмония, плеврит, миокардит, артрит, энцефалит, синдром Гийена-Барре, но наблюдаются они относительно редко. После острой фазы в течение многих недель сохраняется астенизация, иногда вегетативно-сосудистые расстройства.

Диагностика Цитомегаловирусной инфекции:

Дифференциальная диагностика ЦМВ-инфекции довольно затруднительна из-за отсутствия или разнообразия клинических проявлений.

Для диагностики ЦМВ-инфекции необходимо использовать одновременно 2-3 лабораторных теста. Исследуют слюну, промывные воды, полученные при бронхолегочном лаваже, мочу, ликвор, кровь, грудное молоко, секционный материал, биоптаты. В связи с термолабильностью вируса материал для исследования должен быть доставлен в лабораторию не позже четырех часов от момента забора.

Обследование проводят вирусологическим, цитологическим, серологическим методами. Выявление специфически измененных клеток ЦМК — наиболее доступный метод, однако его информативность составляет 50-70%. Наиболее достоверно выявление в материале самого вируса или его ДНК. Золотым стандартом до сих пор остается вирусологический метод. Он наиболее достоверный, но для его выполнения требуется значительное количество времени, поэтому ретроспективный характер диагностики не позволяет проводить адекватную терапию и профилактику.

Для диагностики необязательно выделять сам вирус, достаточно выделить его антиген. Для этого широко используют реакцию иммунофлюоресценции (РИФ), иммуноферментный анализ (ИФА), ДНК-ЦМВ-гибридизацию, полимеразную цепную реакцию (ПЦР).

Метод ПЦР благодаря своей высокой чувствительности выявляет даже отрезок ДНК ЦМВ и считается весьма прогрессивным. Наиболее важное его преимущество — возможность диагностики ранних стадий процесса, латентной и персистирующей инфекции, однако он имеет два существенных недостатка. Во-первых, низкую прогностическую ценность, связанную с тем, что ПЦР выявляет ДНК вируса даже в латентном состоянии. Во-вторых, этод метод недостаточно специфичен.

В последние годы наиболее широкое распространение получил метод ИФА, который позволяет выявить антиген ЦМВ и специфические антитела классов G и М. Выявление IgG имеет второстепенное значение. Оно должно осуществляться одновременно с выявлением IgМ, особенно для диагностики первичной инфекции. При однократном выявлении IgG анализ уровня их авидности (способности удерживать антиген) может помочь в дифференциации между активной и персистирующей инфекцией.

Нужно иметь в виду, что специфические антитела могут не выявляться у лиц со сниженным иммунитетом, при белковом голодании и т. д. Определение IgG необходимо проводить в парных сыворотках с интервалом не менее 10 дней.

Рецидивирующая форма ЦМВИ диагностируется при повторном выделении вируса у серопозитивных лиц.

Диагноз внутриутробной ЦМВИ устанавливается на протяжении первых трех недель жизни. Наличие IgМ у новорожденного до двух недель жизни свидетельствует о внутриутробной инфекции, после — о приобретенной.

Аффинность и авидность антител
Важность диагностики первичной цитомегаловирусной инфекции у беременных привело к изучению свойств антител, вырабатываемых организм в ответ на инфекцию.

Были установлены два основных свойства антител:
• Афинность — степень специфического сродства антитела к антигену возбудителя
• Авидность – степень прочности связывания молекулы антитела с молекулой антигена

Установлена тесная взаимосвязь между ними, чем выше аффинность, тем прочнее антитело связывается с антигеном (выше авидность). Степени аффинности и авидности позволяют установить возраст антител класса G и по нему судить о давности инфицирования и о течении инфекционного процесса (латентное течение, рецидив). О первичной фазе инфекции судят по наличию вирусоспецифических антител IgM, срок присутствия которых в организме в организме составляет нескольких недель — месяцев. Повышение уровня IgG происходит в течение нескольких недель. Вначале образуются низкоафинные антитела, которые образуются при активном размножении вируса в организме и сохраняющиеся в течение до 1,5 мес. от начала заболевания. Далее организм вырабатывают высокоафинные антитела класса IgG, которые сохраняются длительное время. Высокоафинные антитела остаются в организме длительное время, обеспечивая иммунитет от инфекции.

Для различия первичной и латентной инфекции определяют авидность антител класса G. Если в крови обнаруживаются низкоавидные IgG, то это свидетельствует о первичной инфекции. Обнаружение высокоавидных антител G свидетельствует о латентной или перенесенной инфекции. Если в организме присутствуют высокоавидные антитела G и IgM то можно предположить реактивацию латентной инфекции или повторное проникновение вируса в организм. говорит о вторичном иммунном ответе в случае попадания возбудителя в организм или обострения (реактивации).

В количественном отношении определяют так называемый индекс авидности.

Индекс авидности до 30% свидетельствует о наличие низкоавидных антител и соответственно о первичной инфекции, 30-40% — о поздней стадии первичной инфекции или недавней перенесенной инфекции, индекс свыше 40% — о давней перенесенной инфекции.

Лечение Цитомегаловирусной инфекции:

Лечение цитомегаловирусной инфекции представляет определённые трудности, так как интерферон и многие противовирусные средства (ацикловир, видарабин, виразол) оказались неэффективными, а в некоторых случаях их применение вызывает парадоксальные реакции. Ганцикловир замедляет развитие цитомегаловирусного ретинита, но мало резуль¬тативен при поражениях лёгких, мозга, органов ЖКТ. Определённые перспективы имеет препарат фоскарнет. Возможно применение антицитомегаловирусного гипериммунного человеческого иммуноглобулина. Для лечения женщин с отяго¬щенным акушерским анамнезом предложено назначать иммуномодуляторы (левамизол, Т-активин).

Мононуклеозоподобные формы инфекции специфического лечения не требуют.

Для терапии тяжелых форм ЦМВИ у иммунокомпрометированных лиц и внутриутробной ЦМВИ у новорожденных используют ганцикловир. Он подключается в цикл размножения вируса и прерывает его. После отмены ганцикловира возможны рецидивы. Препарат имеет ряд побочных эффектов в виде нейтропении, тромбоцитопении, поражения печени и почек, поэтому детям его назначают по жизненным показаниям. Лечение проводят под контролем анализа крови каждые два дня.

Эффективным считается назначение интерферонов.

На современном этапе важным является комбинирование противовирусных препаратов с интерферонами, что способствует элиминации ЦМВ (сочетание ацикловира с a-интерфероном), а также взаимопотенцирует противовирусное действие, снижает токсичность препаратов (ганцикловир с индукторами интерферона, наиболее удачна его комбинация с амиксином). Одновременно назначают средства для коррекции иммунной дисфункции.

Специфический антицитомегаловирусный иммуноглобулин вводят внутримышечно по 3 мл ежедневно в течение 10 дней. Он содержит 60% специфических к ЦМВ антител.

Неспецифические иммуноглобулины для внутривенного введения (Сандоглобулин) назначают для профилактики ЦМВИ у иммунокомпрометированных лиц. Их эффективность ниже, чем специфических иммуноглобулинов.

Эффективным для профилактики ЦМВИ у серонегативных реципиентов является использование иммуноглобулинов в комбинации с ацикловиром или валацикловиром.

Вагинально используют 0,25% бонафтоновую, оксолиновую, риодоксолевую, 0,5% теброфеновую, флореналевую, 1% интерфероновую, 3-5% ацикловировую мази 3-5 раз в день в течение 12-15 дней (мази необходимо менять каждые 10-14 дней).

Для лечения ротовой полости используют эти же препараты в виде растворов, а также 0,5% этоний, 1:5000 фурацилин, 1-5% аминокапроновую кислоту; при грибковых осложнениях — 1% йодинол и 0,25% риодоксолевую мазь.

При ретините, поражении ЦНС, пневмонии у иммунокомпрометированных лиц наиболее эффективны ганцикловир или фоскарнет, курс лечения — 14-21 день.

Профилактика Цитомегаловирусной инфекции:

Специфическая профилактика не разработана. При переливании крови следует использовать кровь здоровых доноров, не содержащую антитела к ЦМВ, тоже относится и к пересадке внутренних органов. Показано применение с профилактической целью специфического гипериммунного иммуноглобулина в группах риска (реципиентам костного мозга, сердца, почек и печени; больным, получающим цитостатические препараты, беременным). В профилактике врождённой инфекции большое значение имеет предупреждение контактов беременных с больными, строгое соблюдение противоэпидемического режима в родовспомогательных учреждениях. Дети, родившиеся от матерей с ЦМВ-инфекцией и не имеющие признаков инфицирования, не подлежат грудному вскармливанию. В случае рождения ребёнка с ЦМВ-инфекцией повторную беременность можно рекомендовать не ранее чем через 2 года.

Меры профилактики ЦМВ-инфекции у беременных
Никакие меры не могут полностью исключить риск заражения, но соблюдение этих правил уменьшит вероятность инфицирования ЦМВ.

1. Тщательно мойте руки с мылом в течении 15-20 минут, особенно после смены подгузников (памперсов) у грудных детей
2. Никогда не целуйте детей младше 5 лет в губы
3. Выделите для себя и маленьких детей отдельную посуду и столовые приборы
4. Если вы работаете в детских учреждениях (яслях, деттских садах) на время беременности возьмите отпуск или резко ограничьте контакты с детьми.

К каким докторам следует обращаться если у Вас Цитомегаловирусная инфекция:

Вас что-то беспокоит? Вы хотите узнать более детальную информацию о Цитомегаловирусной инфекции, ее причинах, симптомах, методах лечения и профилактики, ходе течения болезни и соблюдении диеты после нее? Или же Вам необходим осмотр? Вы можете записаться на прием к доктору – клиника Eurolab всегда к Вашим услугам! Лучшие врачи осмотрят Вас, изучат внешние признаки и помогут определить болезнь по симптомам, проконсультируют Вас и окажут необходимую помощь и поставят диагноз. Вы также можете вызвать врача на дом. Клиника Eurolab открыта для Вас круглосуточно.

Как обратиться в клинику:
Телефон нашей клиники в Киеве: (+38 044) 206-20-00 (многоканальный). Секретарь клиники подберет Вам удобный день и час визита к врачу. Наши координаты и схема проезда указаны здесь. Посмотрите детальнее о всех услугах клиники на ее персональной странице.

Если Вами ранее были выполнены какие-либо исследования, обязательно возьмите их результаты на консультацию к врачу. Если исследования выполнены не были, мы сделаем все необходимое в нашей клинике или у наших коллег в других клиниках.

У Вас ? Необходимо очень тщательно подходить к состоянию Вашего здоровья в целом. Люди уделяют недостаточно внимания симптомам заболеваний и не осознают, что эти болезни могут быть жизненно опасными. Есть много болезней, которые по началу никак не проявляют себя в нашем организме, но в итоге оказывается, что, к сожалению, их уже лечить слишком поздно. Каждое заболевание имеет свои определенные признаки, характерные внешние проявления – так называемые симптомы болезни. Определение симптомов – первый шаг в диагностике заболеваний в целом. Для этого просто необходимо по несколько раз в год проходить обследование у врача, чтобы не только предотвратить страшную болезнь, но и поддерживать здоровый дух в теле и организме в целом.

Если Вы хотите задать вопрос врачу – воспользуйтесь разделом онлайн консультации, возможно Вы найдете там ответы на свои вопросы и прочитаете советы по уходу за собой. Если Вас интересуют отзывы о клиниках и врачах – попробуйте найти нужную Вам информацию в разделе Вся медицина. Также зарегистрируйтесь на медицинском портале Eurolab, чтобы быть постоянно в курсе последних новостей и обновлений информации на сайте, которые будут автоматически высылаться Вам на почту.


Другие заболевания из группы Инфекционные и паразитарные болезни:

Если Вас интересуют еще какие-нибудь виды болезней и группы заболеваний человека или у Вас есть какие-либо другие вопросы и предложения – напишите нам, мы обязательно постараемся Вам помочь.

ПОЧЕМУ У РЕБЕНКА УВЕЛИЧЕНА ПЕЧЕНЬ И СЕЛЕЗЕНКА

Потому что причины могут быть самыми разными: от несерьёзных до очень опасных. Что означает гепатомегалия у детей Причины увеличения печени Симптомы патологии Диагностические мероприятия Как лечат гепатомегалию у детей Увеличение селезёнки Увеличение желчного пузыря Возможные осложнения. Эту статью проверил и отредактировал кандидат медицинских наук врач-токсиколог Станислав Радченко.

Дорогие читатели! Наши статьи рассказывают о типовых способах решения проблем со здоровьем, но каждый случай носит уникальный характер.

Если вы хотите узнать, как решить именно Вашу проблему — начните с программы похудания. Это быстро, недорого и очень эффективно!

Узнать детали

Увеличение печени и селезенки у ребенка

Детский гастроэнтеролог. Кандидат медицинских наук. Сфера профессиональных интересов: коррекция микробиоценоза при кишечных расстройствах и атопических дерматитов, использования пробиотиков, бактериофагов, антисептиков и других препаратов. На нашем проекте. Более болезней. Заказ лекарств. Первая помощь. Задать вопрос. Увеличение печени и селезенки у ребенка. Девочка 6 месяцев, было сделано два УЗИ органов брюшной полости с разницей в 27 дней. По результатам первого исследования, печень: размеры долей печени не изменены передне -задний размер правой доли мм, левой доли- 36 мм.

Воротная вена 4,2 мм. Селезенка:размеры 46 х19 мм. Селезеночная вена-2,8 мм. Все остальные показатели в пределах нормы. Лимфоузлы в воротах печени, селезенки, мезентериальные — не визуализируются.

По результатам второго исследования, печень: топография не изменена, размеры выше возрастной нормы, соотношение сегментов не изменено:правая доля мм, левая доля 47 мм, первый сегмент мм. Паренхима обычной эхогенности, однородная. Сосуды не изменены, воротная вена в проекции до 6 мм, желчные протоки не расширены, не деформированы.

Холедох в проекции ворот не расширен. Селезенка: топография не изменена, контуры четкие, ровные, паренхима обычной эхогенности, однородная. Размеры увеличены: 64 х 27 мм. Селезеночная вена в проекции ворот до 4 мм. Брюшная полость: свободной жидкости и патологических включений не выявлено. Мезентериальные лимфоузлы единичные увеличены. Заключение: Увеличение размеров печени и селезенки без изменения эхоструктуры. Второе УЗИ органов брюшной полости было сделано в условиях стационара, так как при проведении первого у ребенка была диагностирована фолликулярная киста правого яичника.

Подскажите пожалуйста, какие анализы и исследования следует пройти чтобы определить причину такого увеличения печени и селезенки? Отвечает Борщ Светлана Корнеливна. По результатах второго УЗИ в наличии существенное увеличение левой доли печени и селезёнки. При таких результатах следует обращаться к гематологу для исключения гемолитических анемий, в первую очередь наследственного микросфероцитоза болезни Минковского-Шоффара и других заболеваний крови.

Возможны гемолитические или гипопластические крызисы. Также следует исключить заболевания печени и сердца. По итогам полученной консультации, пожалуйста, обратитесь к врачу, в том числе для выявления возможных противопоказаний. Заказать нужный препарат с доставкой в ближайшую аптеку. О консультанте. Гастроэнтерология , Терапия. Ивано-Франковский медицинский институт, Национальный медицинский университет Украины.

Место работы. Централизированная бактериологическая лаборатория центральной городской больницы г. Похожие вопросы. Увеличение печени и селезенки у ребенка 5 лет. Сынуле 5 лет, заболели, была однократная рвота и стал хуже кушать, нам назначили узи брюшной полости и анализы, анализ на общий анализ крови без измениений, все хорошо, анализ мочи Увеличение печени и селезёнки у месячного ребенка.

Здравствуйте, у полутора месячного ребенка увеличены печень и селезёнка по УЗИ и плохой общий анализ крови. Может ли это быть заболеванием крови? У ребенка 12 лет по УЗИ показало увеличение печени и селезенки. Мой сын 7 лет занимается спортом хоккей. Увеличена печень и селезенка у ребёнка 1 1 год. Увеличена печень и селезенка у годовалого ребёнка Добрый день! Дело в следующем, сдавали мы общий анализ крови, ничего не обычного, стандартная процедура для малышей, но все пошло не так.

Здравствуйте, 3 недели назад перенесли инфекционный мононуклеоз. Сдавали кровь на вирусы и был подтвержден ВЭБ и мегалоцитовирус. Печеночные пробы в норме. Температура у ребенка 3 5 года 3 недели и небольшое увеличение печени и селезенки.

Здравствуйте, ребенок 3,5 года. На пятый день высыпания прекратились. Через неделю заболел папа красное горло, темп максимум 37, Увеличенная печень и селезенка у ребенка. Добрый день! Я усыновляю ребёнка. На данный момент ему 3 года 11 месяцев. Из официальных диагнозов: кариес. В мед. Карте все врачи кроме стоматолога написали пометку. Все прививки сделаны, Подпишитесь на нас.

Новости Здоровье Mail. Информация предоставляется в справочных целях. Не занимайтесь самолечением. При первых признаках заболевания обратитесь к врачу.

Ru О компании Реклама. Редакция Наши эксперты Соглашение с консультантами Помощь.

У ребенка увеличена печень и селезенка

Детский гастроэнтеролог. Кандидат медицинских наук. Сфера профессиональных интересов: коррекция микробиоценоза при кишечных расстройствах и атопических дерматитов, использования пробиотиков, бактериофагов, антисептиков и других препаратов. На нашем проекте.

Увеличена печень и селезенка у малыша 2 года

Универсальный ультразвуковой сканер высокого класса, ультракомпактный дизайн и инновационные возможности. Селезенка редко поражается первично, но практически всегда изменяется при гематологических, онкологических, иммунных, сосудистых, инфекционных, системных заболеваниях. Однако обнаружить эти изменения непросто. Ситуацию с выявлением патологии селезенки и возможностью динамического наблюдения радикально изменили ультразвуковые исследования. Селезенка — уникальный орган даже по своему генезу.

Клиническая трактовка результатов ультразвуковых исследований печени

Легкость и удобство в новом объеме. У постели пациента, в операционной или на спортивной площадке — всегда готов к использованию. Ультразвуковые исследования УЗИ — часто первые в ряду диагностических поисков при подозрении на патологию печени, определяя выбор других методик. Совершенствование ультразвуковых диагностических технологий привело к тому, что в ряде случаев стало возможным отказаться от других радиологических исследований. Но это же повышает ответственность специалиста, требует клинически интерпретировать полученные результаты, не сводя описание к фиксации «эхопозитивных» и «эхонегативных» образований. Основная доля УЗИ в поликлинических условиях приходится на органы брюшной полости. И печень — первое, что в этом случае пытается визуализировать специалист. Заболевания печени могут быть заподозрены по предъявляемым жалобам, клинической картине, лабораторным данным, но нередко они выявляются случайно.

Мы собрали самые волнующие вопросы мам, и обратились к профессиональной команде детских специалистов!

Самые волнующие вопросы мам! Ответы!

Патомеханизм и причины. При объективном обследовании взрослых селезенка не должна пальпироваться. Признаки гиперспленизма не зависят от степени увеличения селезенки. Если увеличение вызвано напр. В случае увеличения селезенки при лимфопролиферативных новообразованиях признаки гиперспленизма, даже при большой селезенке, не настолько выражены, как при портальной гипертензии или болезни Гоше.

Детский гастроэнтеролог. Кандидат медицинских наук.

.

ВИДЕО ПО ТЕМЕ: О самом главном: Болезни селезенки, ангина, подготовка к экзаменам без вреда для здоровья

Род: Megalocytivirus — Iridoviridae — dsDNA Viruses

Отличительные признаки

Мегалоцивирусы поражают несколько видов пресноводных и морских рыб. Хотя они морфологически похожи на ранавирусы, уникальный компонент их геномов немного больше (111–112 т.п.н.), чем у большинства ранавирусов, за исключением представителей видов Singapore grouper iridovirus и , вируса эпизоотического гематопоэтического некроза , но меньше, чем у представители четырех других родов в семье.Мегалоцитивирусы отличаются от ранавирусов и лимфоцистивирусов своей способностью вызывать заметное увеличение клеток в инфицированных тканях и анализом последовательности ключевых вирусных генов, например, АТФазы и МСР, для которых были разработаны праймеры для ПЦР. Большинство мегалоцитивирусов демонстрируют> 94% идентичности последовательностей в этих генах, тогда как идентичность последовательностей с ранавирусами и лимфоцистивирусами составляет <50%. Инфекции in vivo приводят к системным, часто опасным для жизни заболеваниям и характеризуются появлением увеличенных клеток, называемых клетками, несущими тельца включения.Клетки, несущие тельца включения, представляют собой гипертрофированные клетки, содержащие крупные пенистые или зернистые базофильные включения, которые расширяют цитоплазму и вытесняют ядро; они патогномоничны для заражения мегалоцивирусами.

Вирион

Морфология

Вирионы обладают икосаэдрической симметрией и имеют диаметр 140–200 нм. Вирионы инактивируются нагреванием (56 ° C в течение 30 мин), гипохлоритом натрия, УФ-облучением, хлороформом, эфиром и воздействием ph4 или ниже и ph21 или выше.

Физико-химические и физические свойства

Физические свойства могут быть аналогичны свойствам других членов семейства (см. Описание семейства)

Нуклеиновая кислота

Полные геномы по крайней мере восьми мегалоцивирусов, т. Е. Вируса инфекционного некроза селезенки и почек (ISKNV), иридовируса морского леща (RBIV), иридовируса красного морского леща (RSIV), иридовируса оранжевого пятнистого окуня (OSGIV), иридовируса красного тельца камбалы (TRBIVID). ), иридовируса желтого горбыля (LYCIV), иридовируса гигантского морского горбуна (GSIV) и вируса чешуйчатой ​​болезни (SDDV).Частицы мегалоцивируса содержат одну линейную молекулу дцДНК размером от 110 104 до 112 636 п.н. с содержанием G + C 53–55%. Как и в случае с другими членами этого семейства, геномная ДНК имеет циклическую перестановку, избыточность на концах и высокую степень метилирования.

Белки

Белковый состав мегалоцитивирусов окончательно не изучен. Исследование вирусных геномов указывает на присутствие от 93 до 135 предполагаемых генов.

Организация и репликация генома

Предполагается, что репликация мегалоцитивирусов аналогична репликации вируса лягушки 3.Однако, учитывая, что существует ряд предполагаемых ORF, которые являются специфичными для рода, также вероятно, что репликация мегалоцивируса отличается в некоторых аспектах.

Биология

Иридовирусы, поражающие красный лещ, мандариновую рыбу и более 30 других видов морских и пресноводных рыб, известны с конца 1980-х годов. Изоляты красного морского леща (RSIV) и мандариновой рыбы (ISKNV) широко изучены (Kurita and Nakajima 2012). In vivo вирусная инфекция характеризуется образованием клеток, несущих тельца включения (IBC).IBC часто появляются в кроветворных тканях, то есть в селезенке и почках, жабрах, пищеварительном тракте и других тканях. Также наблюдаются некротизированные спленоциты. Передача была продемонстрирована при кормлении, парентеральной инъекции и воздействии окружающей среды. Мегалоцивирусы естественным образом инфицируют и вызывают значительную смертность пресноводных и морских рыб на объектах аквакультуры в Китае, Японии и Юго-Восточной Азии. Инфекции недавно были обнаружены в Австралии и Северной Америке. Неполный список восприимчивых видов рыб включает мандариновую рыбу ( Siniperca chuatsi ), красный морской лещ ( Pagrus major ), морской окунь ( Epinephelus spp.), желтохвост ( Seriola quinqueradiata ), полосатый клювовый окунь ( Oplegnathus fasciatus ), красный барабан ( Sciaenops ocellata ), флоридский помпано ( Trachinotus carolinus ) и африканский лампелоид (this). Вирус растет в нескольких культивируемых линиях клеток рыб и вызывает характерное увеличение инфицированных клеток. Вспышки болезней, вызываемых ISKNV, возникают только у рыб, выращиваемых при температуре> 20 ° C. Была разработана вакцина, направленная против RSIV, что позволяет предположить, что инфекция / иммунизация способна вызывать защитные антитела.

Антигенность

Моноклональные антитела, нацеленные на иридовирус красного морского леща, выявляют ISKNV в иммунофлуоресцентных анализах антител, но не распознают ранавирусы рыб. Перекрестная реактивность среди мегалоцивирусов, вероятно, отражает высокий уровень аминокислотной идентичности вирусных белков. Были разработаны вакцины с использованием инактивированного вируса или рекомбинантных белков, и первые были лицензированы для коммерческого использования.

Образование имен

Мегалоцивирусы были названы в честь вызываемого ими заболевания (например,g., вирус инфекционного некроза селезенки и почек, вирус чешуйчатой ​​болезни ) или вид-хозяин (иридовирус красного морского леща), который они заражают.

Критерии демаркации видов

На основании анализа последовательности и серологических исследований все выделенные на сегодняшний день мегалоцитивирусы, по-видимому, являются штаммами двух вирусных видов. Филогенетический анализ указывает на присутствие двух кластеров: один большой кластер состоит из RSIV, ISKNV, TRBIV и других очень похожих вирусов, а второй, более удаленный, кластер состоит из одного изолята, SDDV (Рисунок 6. Iridoviridae ). Остается решить, представляют ли члены более крупного кластера отдельные виды или штаммы одного вида. Как правило, вирусы, подобные ISKNV, были выделены из пресноводных рыб, тогда как вирусы, подобные RSIV, заражают морских рыб.

Виды-члены

Типовой изолят вида

c Инфекционный вирус почек и почек
Виды Название вируса Изолят Регистрационный номер Номер RefSeq Доступная последовательность Сокращение вируса.
Вирус инфекционного некроза селезенки и почек вирус инфекционного некроза селезенки и почек AF371960 NC_003494 Полный геном ISKNV
иридовирус оранжевого пятнистого окуня AY894343 Полный геном OSGIV
Вирус инфекционного некроза селезенки и почек Геном иридовируса гигантского морского окуня K180 GSIV-K1
Вирус инфекционного некроза селезенки и почек иридовирус каменного леща KOR-TY1 AY532606 Полный геном RBIV
Инфекционный и вирус некроза почек иридовирус тюрбо красноватого тельца GQ273492 Полный геном TRBIV
Инфекционный вирус некроза селезенки и почек большой желтый горбыль геном 9 0096 NC_027778
Вирус большого желтого горбыля LYCIV
Вирус инфекционного некроза селезенки и почек pompano iridovirus 2010 MK098185 Полный геном PIV
PIV
necrosis вируса иридовирус красного морского леща Ehime-1 BD143114 Полный геном RSIV
Вирус болезни падения чешуи Вирус болезни падения чешуи C4575 KR139659 Частичный геном SDDV
Названия вирусов, выбор типичных изолятов и сокращения вирусов не являются официальными обозначениями ICTV.

Родственные, неклассифицированные вирусы

Название вируса

Регистрационный номер

Аббревиатура вируса

Геном (п.н.)

ORF

% GC

Иридовирус голавля

MK637631

ECIV

128 216

108

39%

Названия и сокращения вирусов не являются официальными обозначениями ICTV.
ND: не определено.
В эту таблицу включены только изоляты, геном которых полностью секвенирован. Филогенетический анализ предполагает, что ECIV может представлять новый вид в пределах рода.

Полная последовательность генома мегалоцивируса (семейство Iridoviridae), связанного со смертностью камбалы в Китае | Virology Journal

Определение последовательности вирусной геномной ДНК

ПЦР проводили с использованием праймеров — MCP-irido5: 5 ‘GGAAGCTTCAAGTGAGGAGCG TGA 3’ и MCP-irido6: 5 ‘GGGAATTCACAGGATAGGGAAGCC 3’, которые были разработаны на основе MCP of SBIV Sudthongkong et al.[19] использовался и использовался для амплификации C-конца кодирующей области SBIV, RSIV, GSDIV, ALIV и DGIV для выявления больных камбалой. Секвенирование продуктов ПЦР показало, что область TRBIV показала высокую степень идентичности последовательности с SBIV (98%), RSIV (98%), GSDIV (98%), ALIV (98%), DGIV (98%) и RBIV. (97%) идентичность аминокислотной последовательности также была выше, чем у других иридовирусов, таких как CIV, MIV, TFV, FV-3, LCDV, LCDV-1, ATV, GIV и SGIV. Впоследствии, после завершения секвенирования MCP и АТФазы TRBIV, результаты анализа последовательности показали, что TRBIV был гораздо более тесно связан с RSIV, ISKNV, RBIV, OSGIV и LYCIV, чем с другими иридовирусами.Затем мы разработали пары праймеров на основе консервативных генов ISKNV, OSGIV и RBIV для амплификации генома TRBIV. Амплифицированные продукты ПЦР имели длину примерно 2000 ~ 6000 п.н. Первоначальные продукты ПЦР были разработаны так, чтобы иметь перекрывающуюся последовательность не менее 200 п.н. Продукты ПЦР клонировали в вектор pMD18-T и секвенировали в обоих направлениях с универсальными прямым и обратным праймерами M13 с использованием автоматического секвенатора ДНК ABI PRISM 3700. Наконец, было достигнуто примерно 6-кратное покрытие последовательности генома TRBIV.

Геном TRBIV содержал двухцепочечную ДНК, состоящую из 110 104 п.н., с содержанием G + C 55%. Среди секвенированных мегалоцитивирусов размер генома TRBIV был самым маленьким по сравнению с геномом ISKNV (111 362 п.н.), LYCIV (111 760 п.н.), RBIV (112 080 п.н.), RSIV (112 414 п.н.) и OSGIV (112 636 п.н.) [13– 15]. По сравнению с другими секвенированными иридовирусами размер генома TRBIV был выше, чем у LCDV-1 (102 653 п.н.), TFV (10 05 057 п.н.), FV-3 (105 903 п.н.), ATV (106,332 п.н.), но меньше, чем у SGIV. (140 131 п.н.), LCDV-C (186 250 п.н.) и намного меньше, чем у CIV (212 482 п.н.) [6, 8–12, 17].Содержание G + C в геноме TRBIV было таким же, как у ISKNV (54,8%), OSGIV (54%), RBIV (53%), FV-3 (55%), TFV (55%), ATV (54%). ) и SGIV (48,64%), но намного выше, чем у LCDV-1 (29,1%), LCDV-C (27,25%) и CIV (28,6%) (Таблица 1).

Таблица 1 Сводка геномной информации для 13 секвенированных иридовирусов

Геном TRBIV содержал многочисленные короткие прямые, инвертированные и палиндромные повторяющиеся последовательности. Область с высокой (прямой) повторяемостью была идентифицирована в положениях от 23 512 до 23 762 п.н. в геноме TRBIV, который также был обнаружен в ISKNV и OSGIV [14, 15].Область с высокой (прямой) повторяемостью продемонстрировала высокую степень гомологии с повторяющимися областями ISKNV (78%) и OSGIV (78%).

Кодирующая способность генома TRBIV

Прогнозирование предполагаемых генов было выполнено с использованием программы прогнозирования вирусных генов DS GENE 1.5 (Accelrys Inc.) и NCBI ORF finder http://www.ncbi.nlm.nih.gov/gorf /gorf.html. Всего было идентифицировано 115 предполагаемых ORF, кодирующих белки от 40 до 1168 аминокислот на смысловой (R) и антисмысловой (L) цепях ДНК (рис.1 и Дополнительный файл 1). Процентная плотность кодирования TRBIV составляет 92%, что аналогично ISKNV (93%), OSGIV (91%) и RBIV (86%) [13–15]. Из 115 ORF 65 (56,5%) кодировались ORF, присутствующими в прямой ориентации, и 50 (43,5%) в обратной. 115 ORF содержат 26 ядерных генов, которые можно найти во всех геномах иридовирусов [20].

Рисунок 1

Организация генома TRBIV . Стрелки указывают расположение, ориентацию и предполагаемый размер каждой ORF. Белые стрелки представляют ORF с предсказанной функцией, аналогичной другим организмам, а черные стрелки представляют ORF с неизвестной функцией.

В геноме TRBIV имеется 17 пар перекрывающихся открытых рамок считывания. Одиннадцать из этих 17 пар ORF имеют перекрытие на 1 ~ 7 п.н. Это похоже на ISKNV (ORF 39R и 40L, 45L и 46L, 80L и 81R, 86L и 87R), RBIV (45L и 46L, 57L и 58L), OSGIV (ORF12L и ORF13L, ORF28R и ORF29L, ORF37L и ORF38R, ORF41R и ORF42L, ORF47L и ORF48L, ORF49R и ORF50R, ORF60L и ORF61L, ORF68L и ORF68R, ORF76R и ORF77R, ORF89R и ORF90L, ORF107RL и ORF108L), ATV (ORF 6R и 6bR, 43R и 43b SGR, 43R и 43b (ORF1L и 2R, 7L и 8L, 12L и 13R) [10, 11, 13–15].

Сравнение с другими иридовирусами, выделенными из рыб

TRBIV подобен трем другим мегалоцитивирусам (ISKNV, OSGIV и RBIV) по общей структуре генома и обнаруживает колинеарность между ними. Анализ аминокислотных последовательностей, выведенных из индивидуальных ORF, показал, что 23 из ORF были такими же, как ORF ISKNV, OSGIV, RBIV по размеру и ориентации, с гомологией в диапазоне от 85% до 99% на аминокислотном уровне. 94, 105 и 111 ORF для TRBIV имели гомологию с таковыми для RBIV (58–100%), ISKNV (66–100%) и OSGIV (66–100%) на уровне аминокислот [13–15].Сравнивая TRBIV с ISKNV, 42 ORF имели одинаковый размер, а идентичность варьировалась от 84% до 99%. Сравнивая TRBIV и OSGIV, 37 из 115 ORF были одинакового размера, а их идентичность варьировала от 87% до 99%; 35 из 115 ORF различались по размеру, от 66% до 99%. Сравнивая TRBIV и RBIV, 30 ORF имели одинаковый размер, а идентичность варьировалась от 77% до 100%.

Полную последовательность TRBIV сравнивали со всеми последовательностями иридовируса, доступными в банках данных. Результат показал, что предполагаемые генные продукты TRBIV обладают высокой гомологией с соответствующими вирусными белками других иридовирусов (дополнительный файл 1).Существует 26 основных генов, которые можно найти во всех геномах иридовирусов, таких как сериновые / треониновые протеинкиназы, ДНК-полимераза (DdDP), ДНК-метилтрансфераза (DMet), SNF2-подобная геликаза, белок репарации ДНК (RAD2), большие субъединицы ДНК-зависимая РНК-полимераза (DdRPI и DdRPII), РНКаза III (RIII), АТФаза и МСР. Эти гены участвуют в репликации, транскрипции, модификации и структурном составе вируса.

Сходство последовательностей с белками в базах данных

Выведенные генные продукты 115 ORF сравнивали с аминокислотными последовательностями с помощью программы NCBI BLAST http: // www.ncbi.nlm.nih.gov/BLAST/. Тридцать девять ORF показали значительную гомологию с функционально охарактеризованными белками других видов. Эти белки включали структурные белки и ферменты, участвующие в репликации вируса, транскрипции, модификации белка и взаимодействии вируса с хозяином (дополнительный файл 1).

Репликация и репарация ДНК

Геном TRBIV содержал несколько генов с предсказанной ролью в репликации, модификации и процессинге вирусной ДНК, таких как ДНК-полимераза (ORF20R), белок репарации ДНК RAD2 (ORF27L), цитозиновая ДНК-метилтрансфераза (ORF45L) , предполагаемый фактор репликации (ORF56L), геликаза семейства SNF2 (ORF 58L) и NTPаза семейства D5 (ORF99L).Эти ORF показали 94-98% идентичности с таковыми для ISKNV, OSGIV и RBIV на аминокислотном уровне.

TRBIV ORF45L кодирует гомолог цитозиновой ДНК-метилтрансферазы. Высокие уровни метилирования цитозина по остаткам CpG были идентифицированы у иридовирусов от позвоночных-хозяев, таких как FV3, LCDV-1, EHNV, ISKNV, TFV и OSGIV [7, 15, 20–22]. Метилирование ДНК осуществляется группой ферментов, называемых ДНК-метилтрансферазами. Эти ферменты не только определяют паттерны метилирования ДНК на раннем этапе развития, но также несут ответственность за копирование этих паттернов в цепи, полученные в результате репликации ДНК.У иридовирусов позвоночных метилтрансферазы могут играть решающую роль в экспрессии вирусного генома [7].

TRBIV ORF20R кодировал белок, демонстрирующий значительное сходство с ДНК-полимеразой. ДНК-полимераза катализирует полимеризацию дезоксирибонуклеотидов в цепь ДНК. ДНК-полимеразы наиболее известны своей ролью в репликации ДНК. Как и другие ДНК-полимеразы, ORF20R состоит из 3′-5′-экзонуклеаз и мотивов полимеризации, расположенных на N-концевой и C-концевой частях белка.Эти высококонсервативные мотивы являются важными характеристиками фермента [23, 24].

Транскрипция и метаболизм нуклеотидов

TRBIV кодирует по крайней мере шесть ферментов, которые участвуют в транскрипции и метаболизме нуклеотидов. Это малая субъединица рибонуклеотидредуктазы (ORF25R), две большие субъединицы ДНК-зависимой РНК-полимеразы (ORF28L, ORF33R), фактор элонгации транскрипции IIS (TFIIS, ORF29L), фермент кэпирования мРНК (ORF59L) и рибонуклеаза III (ORF80L). Эти гены TRBIV похожи на гены ISKNV, и они показали идентичность аминокислотных последовательностей на 95 ~ 96%.

TFIIS повсеместно встречается во многих организмах и играет важную роль в удлинении транскриптов [25, 26]. Этапная и тканеспецифическая экспрессия генов является начальным и важным шагом в установлении судьбы каждой клетки во время развития. Экспрессия определенных генов или семейств генов может регулироваться тканеспецифическим S-II на уровне транскрипционной элонгации [27].

Функции, связанные с хозяином

TRBIV кодирует по меньшей мере 15 белков, участвующих в функциях, связанных с хозяином.ORF12R, 60L, 61L, 90L и 110R кодируют белки различных размеров, которые содержат домен убиквитинлигазы, содержащий RING-finger. Они очень гомологичны ISKNV (ORF12R, 65L, 66L, 99L и 119R). Исследование белков безымянного пальца (RFP) показало, что четыре RFP ISKNV (ORF12R, 65L, 66L и 111L) действовали как фермент E3 в присутствии фермента, активирующего убиквитин (E1), убиквитина, ионов цинка и специфических Белок E2 (подсемейство UbcH5). RING-домен RFP в ISKNV (ORF66L) оказался важным для активности фермента E3 с помощью мутационного анализа [28].

ORF36L кодировал белок из 449 аминокислот, который показал гомологию с ORF37L LYCIV, содержащего биологически активный трипептид RGD. Было установлено, что RGD-содержащие белки вовлечены в вирусную инфекцию и взаимодействие вируса с хозяином за счет взаимодействия их мотива RGD с рецепторами на поверхности клетки-хозяина. Исследование 37 л LYCIV показало, что он играет важную роль в вирусной инфекции [29–33]. ORF47R

, который показал гомологию с ORF48R ISKNV, показал более высокое сходство с фактором роста эндотелия сосудов (VEGF), кодируемым мегалоцитивирусом и парапоксвирусом , чем с факторами, кодируемыми рыбами и млекопитающими.VEGF действует как специфический митоген для эндотелиальных клеток сосудов и как мощный индуктор проницаемости сосудов. Исследование ORF48R ISKNV продемонстрировало, что ISKNV ORF48R функционирует как мощный фактор роста для стимуляции ангиогенеза и может связывать свой рецептор, FLK-1, чтобы влиять на раннее эмбриональное развитие сосудов рыбок данио [34].

Кроме того, в геноме TRBIV были обнаружены некоторые важные предполагаемые гены, участвующие в функции, связанной с хозяином, такие как мотивы анкириновых повторов (ORF70R, 93R, 109L, 115L), фосфатаза, подобная С-концевому домену (CTD) (ORF5L). ), ядерный антиген пролиферирующих клеток (ORF9R), белок, содержащий домен Src гомологии 2 (Sh3), домен, подобный эпидермальному фактору роста ламининового типа (EGF) (ORF24R), и фактор, связанный с рецептором фактора некроза опухоли (TRAF, ORF101L) .

Предполагаемые мембранно-ассоциированные белки

ORF TRBIV анализировали на наличие предполагаемых трансмембранных доменов (TM). Один или несколько предполагаемых TM (1 ~ 11) были обнаружены в пяти ORF (ORF1L, 7L, 11L, 48L, 84R, 112L) с использованием компьютерного программного обеспечения TMHMM 2.0 [35]. ORF1L обладает высокой гомологией с аминокислотными последовательностями ORF1L ISKNV и OSGIV [14, 15]. ORF1L ISKNV, содержащий 10 ~ 11 предполагаемых трансмембранных доменов, является мембранным белком и рассматривается как модель для анализа топологии и ролей различных гидрофобных регионов в мульти-трансмембранных белках [36].

Другие белки

TRBIV также кодировал белки, гомологичные фосфатазе (ORF107R), АТФазе (ORF113R) и структурному белку (MCP, ORF6L). ORF6L кодировал белок из 453 аминокислот, который показал сходство с MCP других иридовирусов (т.е. RSIV, DGIV, RBIV, SBIV, OSGIV и ISKNV) [14, 19].

Связь TRBIV с ISNNV, OSGIV и RBIV

Сравнительный анализ геномов TRBIV, ISKNV, OSGIV и RBIV выявил много гомологов (дополнительный файл 1).Многие ORF четырех геномов иридовирусов, включая консервативные гены и другие ORF с неизвестной функцией, были сходными по размеру, структуре и составу. Всего 94, 105 и 111 ORF TRBIV имели гомологию с таковыми RBIV (58–100%), ISKNV (66–100%) и OSGIV (66–100%) на уровне аминокислот [13–15]. Двадцать три ORF TRBIV имели одинаковый размер, а идентичность варьировала от 85% до 99%.

Точечные матричные анализы ДНК геномной ДНК TRBIV с самой собой, ISKNV, OSGIV и геномом RBIV были выполнены с использованием DS GENE 1.5 (Accelrys Inc.). Результаты показали, что порядок генов среди TRBIV, ISKNV, OSGIV и RBIV был заметно консервативным (рис. 2).

Рисунок 2

Точечные матричные графики, сравнивающие геном TRBIV (вертикальная ось) с геномами ISKNV, OSGIV, RBIV и самим геномом (горизонтальная ось) . Горизонтальные оси представляют (A) геном TRBIV; (B) геном ISKNV; (C) геном OSGIV; и (D) геном RBIV. Полные геномные последовательности были выровнены с использованием DS GENE 1.5.

Существует много различных генов по сравнению с ISKNV, OSGIV и RBIV в некодирующей области и кодирующей области TRBIV, включая вставки и делеции генов (результаты не показаны).Интересно, что существует очевидная делеция гена размером около 1070 п.н. по сравнению с ISKNV в положениях 67468 ~ 67518 TRBIV, но практически нет никаких различий с OSGIV и RBIV. Различия генов трех вирусов отражают особенности их хозяев.

Связь TRBIV с другими иридовирусами

Последовательности иридовируса, имеющиеся в банках данных, сравнивали с полной последовательностью TRBIV. Результат показал, что предполагаемые генные продукты TRBIV обладают высокой гомологией с соответствующими вирусными белками других иридовирусов (дополнительный файл 1).Некоторые гомологичные гены присутствовали в геномах ISKNV, OSGIV, RBIV, TFV, FV-3, ATV, SGIV, LCDV-1 и LCDV-C. К ним относятся гены ДНК-полимеразы (DdDP), ДНК-метилтрансферазы (DMet), двух больших субъединиц ДНК-зависимой РНК-полимеразы (DdRPI и DdRPII), РНКазы III (RIII), АТФазы и MCP, участвующих в репликации, транскрипции, модификации вируса. , и структурный состав.

Филогенетический анализ

Чтобы определить филогенетическое родство TRBIV с другими иридовирусами, аминокислотные последовательности МСР, АТФазы, цитозин-ДНК-метилтрансферазы и ДНК-полимеразы были использованы в сопоставлении с другими иридовирусами и неиридовирусами из GenBank.МСР высококонсервативен у иридовирусов [37, 38]. В дереве MCP иридовирусы, использованные в множественных сопоставлениях, были подразделены на четыре группы: группа I, Лимфоцистивирусы , включая LCDV-1 и LCDV-C; группа II, иридовирусы насекомых, включая CIV, MIV; группа III, мегалоцивирусов , включая TRBIV, ISKNV, OSGIV, RBIV; и группа IV — ранавирусов , включая FV3, TFV, ATV, GIV и SGIV (фиг. 3A). Результаты показали, что TRBIV был более близок к ISKNV, OSGIV и RBIV, чем к Ranavirus и Lymphocystivirus .Филогенетический анализ с использованием высококонсервативных полноразмерных белковых последовательностей АТФазы, цитозин-ДНК-метилтрансферазы и ДНК-полимеразы иридовирусов (рис. 3B, C, D) также подтвердил мнение о том, что TRBIV более тесно связан с ISKNV, OSGIV и RBIV. .

Рисунок 3

Филогенетические отношения иридовирусов, полученные с использованием четырех выравниваний последовательностей белков: (A) основной белок капсида, (B) АТФаза, (C) ДНК-полимераза и (D) цитозиновая ДНК-метилтрансфераза .Выравнивание проводилось с использованием Clustal X 1.83, и деревья объединения соседей, полученные с помощью PHYLIP 3.67, показаны со статистической поддержкой, указывающей на надежность предполагаемого шаблона ветвления, оцененного с помощью теста начальной загрузки. Инвентарные номера GenBank: (A) ATV, YP_003785; CIV, NP_149737; MIV, YP_654586; FV3, YP_031669; ИСКНВ, НП_612228; ЖКВ-1, НП_044812; LCDV-C, YP_025102; RBIV, AAT71822; SGIV, AAS18087; GIV, AAV

  • ; TFV, AAL77814; и OSGIV, AAX82316. (B) квадроцикл, AAP33264; CIV, NP_149538; GIV, AAV
    ; ФВ3, YP_031593; OSGIV, AAX82427; ISKNV, AAL98847; ЖКВ-1, НП_078656; LCDV-C, YP_073620; SGIV, YP_164229; MIV, YP_654660; TFV, AAL77796; и RBIV, AY532606.1. (C) квадроцикл, YP_003817; CIV, AAD48150; FV3, YP_031639; ISKNV, AAL98743; ЖКВ-1, НП_078724; LCDV-C, YP_073706; RBIV, AAT71835; SGIV, AAS18143; TFV, AAL77804; OSGIV, AAX82331; и MIV, YP_654692. (D) квадроцикл, YP_003792; FV3, YP_031662; ISKNV, AAL98770; OSGIV, AAX82357; ЖКВ-1, НП_078617; LCDV-C, YP_025103; RBIV, AAT71861; и TFV, NP_572009.

    Распространение и обнаружение мегалоцивируса у декоративных рыб в Таиланде | Журнал рыболовства и окружающей среды

    1. Крейн, M.St.J. и К.Дэвис. 2006 г. Подпрограмма здоровья водных животных: создание диагностической экспертизы для обнаружения и идентификации иридовируса красного морского леща (RSIV). Номер проекта 2003/620 Корпорация исследований и развития рыболовства, Канберра. 78 с.

    2. DAWR (Департамент сельского и водного хозяйства). 2014. Рекомендации по биобезопасности 2014/11-Политика карантина для пресноводных декоративных рыб из утвержденных стран. Https://www.agriculture.gov.au/biosecurity/risk-analysis/animal/ornamental-finfish/quarantine-policy-freshwater-ornamental- страны, одобренные для рыбы.Цитировано 10 сентября 2018 г.

    3. Fraser, W.A., T.J. Киф и Б. Болон. 1993. Выделение иридовируса из выращиваемого на ферме гурамиса (Trichogaster trichopterus) со смертельным исходом. Журнал ветеринарных диагностических исследований 5: 250–253.

    4. Джиас, Э., К. Джонстон, С. Килинг, Р.П. Спенс и У.Л. Макдональд. 2011. Разработка методов ПЦР в реальном времени для обнаружения мегалоцитивирусов у импортных декоративных рыб. Журнал болезней рыб 34: 609-618.

    5. Гибсон-Кю, С., П. Нетто, Г. Нгох-Лим, С.Ф. Чанг, Л.Л. Хо, К.В. Цинь, Ф.Х. Чуа, М.Л. Нг и Х. Фергюсон. 2003. Патология системной иридовирусной болезни рыб. Журнал сравнительной патолологии 129: 111–119.

    6. Го, Дж., М. Ланкастер, К. Дис, О. Дунджел и Р. Уиттингтон. 2006. Молекулярная эпидемиология иридовируса трески Мюррея (Maccullochella peelii peelii) и карликового гурами (Colisa lalia) из отдаленных биогеографических регионов предполагает связь между торговлей декоративной рыбой и возникающими иридовирусными заболеваниями.Молекулярные и клеточные зонды 20: 212–222.

    7. Го, Дж. И Р. Уиттингтон. 2006. Экспериментальная передача и вирулентность мегалоцивируса (семейство Iridoviridae) карликового гурами (Colisa lalia) из Азии у трески Мюррей (Maccullochella peelii peelii) в Австралии. Аквакультура 258: 140–149.

    8. Хилл, Б.Дж. и К. Уэй. 1995. Серологическая классификация вируса инфекционного некроза поджелудочной железы (ИПН) и других акаутических бирнавирусов. Ежегодный обзор болезней рыб 5: 55-77.

    9.Хьюмасон, Г. Л. 1979. Методы использования тканей животных. 4-е издание, W.H. Фриман, Сан-Франциско. 661 стр.

    10. Иноуэ, К., К. Ямано, Ю. Маэно, К. Накадзима, М. Мацуока, Ю. Вада и М. Соримачи. 1992. Иридовирусная инфекция культивируемого красного морского леща Pagrus major. Патология рыб 27: 19–27.

    11. Имаджо, М., Т. Хираяма и С.И. Осима. 2005. Частое возникновение апоптоза не связано с патогенным вирусом инфекционного некроза поджелудочной железы (IPNV) при хронической инфекции. Иммунология рыб и моллюсков 18: 163-177.

    12. Jeong, J.B., H.J. Cho, L.J. Jun, S.H. Хонг, Дж. К. Чанг и Х. Чон. 2008a. Передача иридовируса от пресноводных декоративных рыб (жемчужный гурами) к морским рыбам (каменный лещ). Болезни водных организмов 82: 27–36.

    13. Jeong, J.B., H.Y. Ким, L.J. Jun, J.H. Лю, Н. Парк, Дж. Ким и Х. Чон. 2008b. Вспышки и риски инфекционных заболеваний, вызванных вирусом некроза селезенки и почек, у пресноводных декоративных рыб. Болезни водных организмов 78: 209–215.

    14.Jeong, J.B., L.J. Jun, K.H. Парк, К. Ким, Дж.К. Чунг, Дж.Л. Комисар и Х.Д. Чон. 2006. Бессимптомная иридовирусная инфекция у различных морских рыб, обнаруженная методом 2-этапной ПЦР. Аквакультура 255: 30–38.

    15. Юнг, М.Х., Н. Чамилани, Т.Н. Винай, Дж. Ли и С.Дж. Юнг. 2017. Репликация иридовируса каменного леща (RBIV) у каменного леща (Oplegnathus fasciatus), подвергавшегося в разные периоды времени воздействию чувствительной воды. Иммунология моллюсков рыб 70: 731-735.

    16. Юнг-Шроерс, В., M. Adamek, P. Wohlsein, J. Wolter, H. Wedekind и D. Steinhagen. 2016. Первая вспышка инфекции инфекционным вирусом некроза селезенки и почек (ISKNV) у декоративных рыб в Германии. Болезни водных организмов 119: 239-244.

    17. Julin, K., L.H. Johansen, A.I. Зоммер и Дж.Б. Йоргенсен. 2015. Персистирующая инфекция вирусом инфекционного некроза поджелудочной железы (IPNV) различной вирулентности у атлантического лосося, Salmo salar L. Journal of Fish Diseases 38: 1005-1019.

    18.Ким, W.S., M.J. Oh, J.O. Kim, D. Kim, C.H. Чон и Дж. Ким. 2010. Обнаружение мегалоцивируса у импортных тропических декоративных рыб, райских рыб Macropodus opercularis. Болезни водных организмов 90: 235-239.

    19. Курита Дж. И Дж. Накадзима. 2012. Мегалоцивирусы. Вирусы 4: 521-538.

    20. Курита Дж., К. Накадзима, И. Хироно и Т. Аоки. 1998. Амплификация ДНК иридовируса красного морского леща (RSIV) с помощью полимеразной цепной реакции (ПЦР). Патология рыб 33: 17-23.

    21.Ланестер, М.Дж., М.М. Уильямсон и С.Дж. Шроен. 2003. Связанная с иридовирусом смертность выращиваемой трески Мюррей (Maccullochella peelii peelii). Австралийский ветеринарный журнал 81: 633-634.

    22. Ларсен, Р., Т.П. Рёкенес и Б. Робертсен. 2004. Ингибирование репликации вируса инфекционного некроза поджелудочной железы белком Mx1 атлантического лосося. Журнал вирусологии 78: 7938-7944.

    23. Mohr, P.G., N.J.G. Муди, Л.М. Уильямс, Дж. Хоад, Д.М. Камминс, К. Дэвис и М.Ст.Дж. Кран. 2015. Молекулярное подтверждение вируса инфекционного некроза селезенки и почек (ISKNV) у выращиваемых и импортируемых декоративных рыб в Австралии.Болезни водных организмов 116: 103-110.

    24. Нолан Д., Ф. Стивенс, М. Крокфорд, Дж. Б. Джонс и М. Сноу. 2015. Обнаружение и характеристика вирусов рода Megalocytivirus у декоративных рыб, ввезенных в карантинные помещения на границе с Австралией, представляет собой новый риск для национальной биобезопасности. Журнал болезней рыб 38: 187-195.

    25. О, S.Y., W.S. Ким, М.Дж.О и Т. Нисидзава. 2016. Коэффициенты размножения иридовируса морского леща (RSIV) у каменного леща Oplegnathus fasciatus при разной температуре выращивания рыбы.Патология рыб 51: 194-198

    26. МЭБ (Всемирная организация здравоохранения животных). 2018. Кодекс здоровья водных животных. www.oie.int/en/international-standard-setting/aquatic-code/accessonline/. Цитировано 15 сентября 2018 г.

    27. Паперна И., Виленкин М. и А.П. де Матос. 2001. Иридовирусные инфекции у выращиваемых на фермах тропических декоративных рыб. Болезни водных организмов 48: 17–25.

    28. Reyes-Cerpa, S., F. Reyes-López, D. Toro-Ascuy, R. Montero, K. Maisey, C. Acuňa-Castillo, J.O. Суньер, Д.Парра, А. Сандино и М. Имарай. 2014. Индукция экспрессии противовоспалительных цитокинов с помощью IPNV при хронической инфекции. Иммунология рыб и моллюсков 41: 172-182.

    29. Риммер, А.Е., Дж. А. Беккер, А. Твиди и Р.Дж. Уиттингтон. 2012. Разработка метода количественной полимеразной цепной реакции (КПЦР) для обнаружения иридовирусов карликового гурами (DGIV) и других мегалоцивирусов и сравнение со справочным протоколом Международного эпизоотического бюро (МЭБ). Аквакультура 358-359: 155-163.

    30. Роджер, Х. Д., М. Кобс, А. Макартни и Г. Н. Frerichs. 1997. Системная иридовирусная инфекция у пресноводных рыб-ангелов, Pterophyllum scalare (Lichtenstein). Журнал болезней рыб 20: 69–72.

    31. Сонг, Дж. Ю., С. И. Китамура, С. Дж. Юнг, Т. Миядай, С. Танака, Ю. Фугуда, С. Ким и М.Дж. 2008. Генетическая изменчивость и географическое распространение мегалоцитивирусов3. Журнал микробиологии 46: 29-33.

    32. Subramaniam, K., M. Shariff, A.R. Омар, М. Хаир-Беджо и Б.Длинный. 2014. Обнаружение и молекулярная характеристика вируса инфекционного некроза селезенки и почек из основных штатов, занимающихся разведением декоративных рыб на полуострове Малайзия. Журнал болезней рыб 37: 609-618.

    33. Тамура К., Д. Петерсон, Н. Петерсон, Г. Стечер, М. Ней и С. Кумар. 2011. MEGA5: анализ молекулярной эволюционной генетики с использованием методов максимального правдоподобия, эволюционных расстояний и методов максимальной экономии. Molecular Biology and Evolution 28: 2731-2739.

    34. Вальцек Т.Б., Г. Марти, М.Э. Альфаро, В.Р. Беннет, К.А. Гарвер, М. Хаулена, Э.С. Третий Вебер и Р.П. Хедрик. 2012. Системный иридовирус от трех колюшки Gasterosteus aculeatus представляет собой новый вид мегалоцивирусов (семейство Iridoviridae). Болезни водных организмов 98: 41-56.

    35. Wang, Y.Q., L. Lü, S.P. Weng, J.N. Хуанг, С. Чан и Дж. Он. 2007. Молекулярная эпидемиология и филогенетический анализ инфекционного вируса селезенки и некроза почек морских рыб, подобного (ISKNV-подобному) вирусу.Архивы вирусологии 152: 763–773.

    36. Whittington, R.J. и Р. Чонг. 2007. Мировая торговля декоративными рыбами с точки зрения Австралии: аргументы в пользу пересмотра стратегий анализа рисков импорта и управления ими. Профилактическая ветеринария 81: 92–116.

    Обнаружение ПЦР и филогенетический анализ изолятов мегалоцивируса в выращиваемых гигантских морских окунях Lates calcarifer в Южном Тайване., Viruses

    Обнаружение ПЦР и филогенетический анализ изолятов мегалоцивируса в выращиваемых гигантских морских окунях Lates calcarifer на юге Тайваня.
    Вирусов ( ЕСЛИ 3.816 ) Дата публикации: 2020-06-24 , DOI: 10.3390 / v12060681 Цзя-Мин Цай, Сун-Ланг Хуанг, Чун-Да Ян

    Род Megalocytivirus включает три генотипа, иридовирус красного морского леща (RSIV), вирус инфекционного некроза селезенки и почек (ISKNV) и иридовирус красноватого тела камбалы (TRBIV), и вызвал массовую гибель различных видов морских и пресноводных рыб на Востоке и Юго-Востоке. Азия.Из трех генотипов TRBIV-подобный мегалоцивирус не включен в список вирусов Всемирной организации здравоохранения животных (МЭБ) из-за его географических ограничений и узкого круга хозяев. В 2017 году 39 случаев подозрения на иридовирусную инфекцию было выделено у сеголетков гигантского морского окуня (Lates calcarifer), выращенных на юге Тайваня во время эпизоотий мегалоцивируса. Для идентификации возбудителя была проведена полимеразная цепная реакция (ПЦР) с различными наборами специфических праймеров. Наши результаты показали, что 35 из 39 изолятов гигантского иридовируса морского окуня (GSPIV) были TRBIV-подобными мегалоцивирусами.Для дальнейшей оценки генетической изменчивости нуклеотидные последовательности гена главного капсидного белка (MCP) (1348 п.н.) из 12 из 35 TRBIV-подобных изолятов мегалоцитивируса сравнивали с таковыми из других известных. Высокая идентичность нуклеотидных последовательностей показала, что эти 12 TRBIV-подобных изолятов GSPIV относятся к одному виду. Филогенетический анализ на основе гена MCP показал, что эти 12 изолятов принадлежат к кладе II мегалоцитивирусов TRBIV и отличаются от RSIV и ISKNV. В заключение следует отметить, что изоляты GSPIV, принадлежащие к мегалоцитивирусу TRBIV клады II, были завезены на Тайвань и оказали серьезное влияние на индустрию аквакультуры гигантского морского окуня.

    更新 日期 : 2020-06-24

    Два белка мегалоцитивируса, экспрессируемых in vivo, которые вызывают защитный иммунитет и необходимы для вирусной инфекции

    Реферат

    Мегалоцивирус — это ДНК-вирус с широким кругом хозяев среди костистых рыб.Хотя сообщалось о полных геномных последовательностях ряда изолятов мегалоцивируса, функции большинства генов этого вируса неизвестны. В этом исследовании мы выбрали два иммуногена мегалоцивируса, P247 и P523, которые экспрессировались во время инфекции хозяина и, когда были в форме ДНК-вакцин (pCN247 и pCN523 соответственно), вызывали сильную защиту против смертельного заражения мегалоцивирусом в палтусе ( Scophthalmus maximus ) модель. По сравнению с контрольной рыбой, рыба, вакцинированная pCN247 и pCN523, демонстрировала резко сниженную вирусную нагрузку в тканях и высокие уровни выживаемости.Анализ иммунного ответа показал, что pCN247 и pCN523 (i) индуцировали продукцию специфических сывороточных антител, (ii) вызывали образование цитотоксических иммунных клеток и специфических иммунных клеток памяти, которые отвечали на вторичную стимуляцию антигеном, и (iii) повышали экспрессию генов, участвующих в врожденный и адаптивный иммунитет. Чтобы изучить потенциальную роль P247 и P523 в вирусной инфекции, экспрессия P247 и P523 была подавлена ​​siRNA. Последующее исследование in vivo на инфекцию показало, что нокдаун P247 и P523 значительно нарушает репликацию вируса.Кроме того, анализ транскриптома всего генома показал, что нокдаун P247 и P523 изменяет профили экспрессии 26 и 41 вирусного гена, соответственно, предположительно участвующих в различных аспектах вирусной инфекции. Взятые вместе, эти результаты показывают, что P247 и P523 индуцируют защитный иммунитет у костистых животных и играют фундаментальную роль, необходимую для репликации вируса. Эти наблюдения предоставляют первое свидетельство, которое предполагает вероятную связь между защитной способностью вирусных иммуногенов и их биологическим значением в репликации вируса.

    Образец цитирования: Zhang J, Zhang Bc, Sun L (2015) P247 и P523: два In vivo -экспрессированных мегалоцитивирусных белка, которые вызывают защитный иммунитет и необходимы для вирусной инфекции. PLoS ONE 10 (3): e0121282. https://doi.org/10.1371/journal.pone.0121282

    Академический редактор: Tzong-Yueh Chen, Национальный университет Cheng Kung, Тайвань

    Поступила: 30 ноября 2014 г .; Одобрена: 29 января 2015 г .; Опубликовано: 27 марта 2015 г.

    Авторские права: © 2015 Zhang et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в пределах документ и вспомогательные информационные файлы к нему.

    Финансирование: Работа поддержана грантами Национальной программы фундаментальных исследований Китая (2012CB114406) и Программы ученых Тайшань провинции Шаньдун.Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

    Введение

    Иридовирусы представляют собой семейство вирусов с двухцепочечной ДНК диаметром от 120 до 300 нм. Семейство насчитывает пять родов: Iridovirus , Chloriridovirus , Lymphocystivirus , Ranavirus и Megalocytivirus [1].Из этих родов Megalocytivirus был идентифицирован относительно недавно и признан во всем мире важным патогеном для рыб [2,3]. В Китае тяжелые мегалоцивирусные инфекции были зарегистрированы у мандаринок ( Siniperca chuatsi ) [4], большого желтого горбыля ( Pseudosciaena crocea ) [5], камбалы ( Scophthalmus maximus ) [6] и морского леща (). Oplegnathus fasciatus ) [7]. В других странах, кроме Китая, вспышки заболеваний, связанных с мегалоцивирусом, были зарегистрированы у большого количества разводимых рыб, включая красного морского леща ( Pagrus major ) [8–10], камбалу [11], камбалу ( Paralichthys olivaceus ) [ 12], морского окуня ( Lateolabrax japonicas ) [13] и морского леща [14].Анализ последовательности изолятов мегалоцивируса от разных хозяев по всему миру показал, что Megalocytivirus отчетливо отделен от других родов семейства Iridovirus , и что представители рода Megalocytivirus обладают высококонсервативными генетическими особенностями, такими как размер генома ( примерно 110 т.п.н.), содержание GC (53–55%) и количество генов (115–124) [15–20]. Однако функции генов мегалоцивируса остаются практически неизвестными.

    ДНК-вакцина

    — это генетическая вакцина на основе гена, кодирующего антигенный белок патогена. Он находится на плазмиде, которая при введении целевому животному делает возможным экспрессию гена вакцины через аппарат транскрипции и трансляции животного-хозяина [21,22]. Затем экспрессированный антиген индуцирует специфический иммунный ответ, который защищает животное от заражения соответствующим патогеном. ДНК-вакцина широко изучалась для борьбы с различными заболеваниями, связанными с вирусными патогенами, включая вирусные патогены рыб, такие как вирус инфекционного некроза поджелудочной железы (IPNV), вирус вирусной геморрагической септицемии (VHSV) и болезнь, вызванная вирусом герпеса кои (KHVD) [23–20]. 28].Для семейства Iridovirus были зарегистрированы ДНК-вакцины против иридовируса морского леща и иридовируса морского леща, оба принадлежащих к роду Megalocytivirus [29,30].

    В предыдущих исследованиях мы выделили мегалоцивирус рыб RBIV-C1 и охарактеризовали диапазон его хозяев и геномную последовательность [7,20]. RBIV-C1 очень патогенен для камбалы и каменного леща и содержит геном размером 112 т.п.н. с 119 открытыми рамками считывания (ORF). ORF RBIV-C1 имеют высокие уровни идентичности последовательностей с ORF других изолятов мегалоцивируса, в частности, иридовируса оранжевого окуня (OSGIV), иридовируса морского леща (RBIV) и иридовируса красноватого тельца камбала (TRBIV).В настоящем исследовании мы выбрали две ORF RBIV-C1 с сильным иммунопротекторным свойством в качестве ДНК-вакцин и исследовали иммунный ответ, индуцированный этими вакцинами, на модели турбо. Кроме того, мы также исследовали потенциальную роль этих двух ORF в репликации вируса. Турбот был использован в качестве животной модели в этом исследовании, потому что он является естественным хозяином мегалоцивируса и важным экономическим видом, широко разводимым в Китае, а также во многих других странах. Таким образом, результаты исследования могут быть применены непосредственно для борьбы с мегалоцивирусной инфекцией в аквакультуре.

    Материалы и методы

    Заявление об этике

    исследования на живых животных были выполнены в соответствии с «Положениями об управлении делами в отношении экспериментальных животных», опубликованными в провинции Шаньдун. Исследование и аспекты смертности протокола были одобрены этическим комитетом Института океанологии Китайской академии наук.

    Рыба

    Клинически здоровая молодь камбала ( Scophthalmus maximus ) (в среднем 12.3 г) были приобретены на местной рыбной ферме (Хайян, Циндао, Китай). Рыб поддерживали при 20 ° C и кормили коммерческими сухими гранулами, как описано ранее [30]. Перед экспериментом рыба была проверена на отсутствие патогенов, как описано ранее [30]. ИФА не обнаружил сывороточных антител к обычным патогенам рыб. Перед забором тканей рыбу усыпляли трикаинметансульфонатом (Sigma, Сент-Луис, США), а затем спинной мозг рыбы перерезали скальпелем.

    Конструирование плазмид ДНК-вакцины

    Праймеры, использованные в этом исследовании, перечислены в таблице 1.Плазмиды ДНК-вакцины pCN247 и pCN523, которые экспрессируют His-меченные P247 и P523 соответственно, были сконструированы следующим образом. ORF107 и ORF86 (номера доступа в GenBank AGG37986 и AGG37965 соответственно) мегалоцивируса RBIV-C1, которые кодируют P247 и P523 соответственно, амплифицировали с помощью ПЦР с парами праймеров P247F1 / P247R1 и P523F1 / P523R1 соответственно (таблица 1). Продукты ПЦР вставляли в pEASY-Simple-T (TransGen Biotech, Пекин, Китай), и гены вакцины извлекали из рекомбинантных плазмид путем расщепления с помощью EcoRV / SmaI и вставляли в pCN3 [31] в сайте SmaI, как описано ранее. [30].Endo-Free Plasmid Kit (Omega Bio-tek, Doraville, USA) использовали для получения плазмидной ДНК, свободной от эндотоксина. Качество ДНК было проанализировано, как сообщалось ранее [30].

    Непрямой иммунофлуоресцентный анализ (IFA) для изучения экспрессии вакцинных генов в трансфицированных клетках

    клеток Grunt Fin (GF), {приобретенных в Американской коллекции типовых культур (ATCC), США}, культивировали при 24 ° C в среде DMEM с высоким содержанием глюкозы (HyClone, Logan, США) с добавлением 20% фетальной телячьей сыворотки (FBS) и 1% пенициллин-стрептомицин согласно инструкции поставщика АТСС.Для трансфекции клетки высевали в 24-луночные культуральные планшеты при концентрации 10 5 клеток / лунку и выращивали при 24 ° C до 80% слияния. Затем клетки трижды промывали средой opti-MEM (Invitrogen, Карлсбад, США) и покрывали 1 мл среды opti-MEM. Один микрограмм pCN247, pCN523 или pCN3 смешивали с 2 мкл липофектамина LTX и 1 мкл PLUS (Invitrogen, Карлсбад, США) в 50 мкл среды opti-MEM, и смесь добавляли к клеткам. После 4 ч инкубации при 24 ° C клетки промывали, как указано выше, и покрывали свежей средой DMEM, содержащей 10% FBS.Клетки инкубировали при 24 ° C в течение 48 ч. После инкубации клетки фиксировали 70% этанолом в течение 30 мин при 4 ° C и трижды промывали PBS. Клетки инкубировали с мышиным моноклональным антителом против His (Bioss, Пекин, Китай) (разведение 1/1000) в течение 2 ч при 37 ° C, а затем с меченным FITC козьим антимышиным IgG (Tiangen, Пекин, Китай) ( Разведение 1/1000) в течение 1 ч при 37 ° C. Клетки промывали, как указано выше, и исследовали с помощью флуоресцентного микроскопа (Nikon E800, Япония).

    Получение рекомбинантных белков

    Для получения рекомбинантных P247 (rP247) и P523 (rP523) плазмиды pEt247 и pEt523, которые экспрессируют P247 и P523 соответственно, были сконструированы следующим образом.Кодирующие последовательности P247 (остатки 47–217) и P523 (остатки 115–305) были амплифицированы с помощью ПЦР с парами праймеров P247F2 / P247R2 и P523F2 / P523R2 соответственно (таблица 1). Продукты ПЦР вставляли в pEASY-Simple-T, как указано выше, и фрагменты, содержащие P247 и P523, извлекали из рекомбинантных плазмид путем переваривания EcoRV. Связанные фрагменты P247 и P523 были вставлены в pET259 [32], как описано ранее [33], что привело к pEt247 и pEt523. Приготовление белка проводили, как описано ранее [33], с использованием Ni-NTA агарозы (QIAGEN, Валенсия, США).Очищенные белки диализовали против PBS в течение ночи и анализировали электрофорезом в полиакриламидном геле с додецилсульфатом натрия. Белки окрашивали бриллиантовым синим кумасси R-250 (S1 рис.). Концентрацию белков определяли с помощью набора BCA Protein Assay Kit (Sangon Biotech, Шанхай, Китай).

    Препарат антител

    Для получения антител против rP247 и против rP523 взрослых крыс (приобретенных в Институте контроля лекарственных средств, Циндао, Китай) иммунизировали подкожной инъекцией rP247 или rP523, смешанными с полным адъювантом Фрейнда.Крысам проводили повторную иммунизацию через 14 и 28 дней после первоначальной иммунизации. У крыс брали кровь через 7 дней после последней иммунизации, и из крови получали сыворотки. Титр и специфичность сывороточных антител определяли с помощью иммуноферментного анализа и вестерн-иммуноблоттинга, как описано ранее [34].

    Обнаружение экспрессии P247 и P523 у рыб, инфицированных мегалоцивирусом

    Turbot были инфицированы внутрибрюшинной (i.p.) инъекцией мегалоцивирусом RBIV-C1 [7] (1 × 10 5 копий на рыбу) или PBS.Через 5 дней после заражения у рыб собирали лейкоциты периферической крови (PBL), как описано ранее [35]. Клетки фиксировали 70% предварительно охлажденным этанолом в течение 30 мин при 4 ° C. Клетки трижды промывали PBS и к клеткам добавляли антитела против rP247 и против rP523 (разведение 1/1000), полученные выше. Затем клетки обрабатывали, как описано ранее [36], путем трехкратной промывки PBS и добавления меченного флуоресцеинизотиоцианатом (FITC) козьего антикрысиного IgG (Bioss, Пекин, Китай) (разведение 1/1000).Клетки инкубировали, промывали и ресуспендировали в PBS, как указано выше. Клетки подвергали микроскопическому исследованию с помощью флуоресцентного микроскопа (Nikon E800, Япония).

    Вакцинация

    Вакцинация была проведена, как сообщалось ранее [30]. Каждую из плазмид вакцины ресуспендировали в PBS до концентрации 400 мкг / мл. Четырем группам (N = 70) палтуса (описанных в разделе «Рыба») внутримышечно (в / м) вводили 50 мкл pCN247, pCN523, pCN3 или PBS. С рыбой содержали нормально, как описано выше в разделе «Рыба».Через 7 дней после вакцинации из каждой группы брали по 5 рыб и использовали их для исследования присутствия / экспрессии плазмид вакцинных генов в тканях рыб. Через месяц после вакцинации 10 рыб из каждой группы использовали для анализа сывороточных антител, а оставшуюся рыбу заражали внутрибрюшинно. инъекция 50 мкл мегалоцивируса RBIV-C1, суспендированного в PBS, до 2 × 10 6 копий / мл. Через 24 часа после заражения по 5 рыб из каждой группы исследовали на экспрессию иммунного гена. Через 3 и 5 дней после заражения 10 рыб (5 / временная точка) из каждой группы были исследованы на вирусную нагрузку в селезенке, как описано ранее [7].Остальные 40 рыб контролировались ежедневно (с 7:00 до 22:00) на предмет смертности в течение одного месяца. Умирающих рыб с клиническими признаками кровотечений во рту, брюшной полости и плавниках выбирали и усыпляли передозировкой метансульфоната трикаина. Однако, поскольку не все рыбы, умершие от инфекции, демонстрировали очевидные клинические признаки, а некоторые рыбы с легкими симптомами (например, только кровоизлияние в брюшную полость или плавники) могли в конечном итоге выжить, гуманные процедуры конечной точки не могли быть выполнены для всех рыб, считающихся мертвыми.В результате приблизительно 32% от общей смертности произошло естественным путем без эвтаназии, включая (i) рыбу, умершую без явных клинических признаков, определенных выше, и (ii) рыбу, у которой могли развиться полные клинические признаки в неконтролируемом периоде. ночью и умер до 7 утра следующего дня. Умирающую рыбу случайным образом отбирали для исследования вируса в печени, почках и селезенке, как описано выше. Относительный процент выживаемости (RPS) рассчитывался, как сообщалось ранее [30].Эксперимент по вакцинации проводили трижды (включая предварительные испытания).

    Обнаружение вакцинных плазмид и экспрессия вакцинных генов в тканях рыб

    Через 7 дней после вакцинации у вакцинированных рыб были взяты ткани и использованы для экстракции ДНК и РНК, как сообщалось ранее [30]. ПЦР-детекцию pCN247, pCN523 и pCN3 проводили с парами праймеров P247F1 / HisR, P523F1 / HisR и CNF1 / HisR соответственно (таблица 1). Экспрессию вакцинных генов из pCN247 и pCN523 проводили с помощью ОТ-ПЦР, как описано ранее [33], с парами праймеров P247F1 / HisR и P523F1 / HisR, соответственно (Таблица 1).P247F1 и P523F1 специфичны для P247 и P523 соответственно, тогда как HisR специфичен для His-последовательности в плазмиде.

    Количественная ПЦР с обратной транскрипцией в реальном времени (qRT-PCR)

    Через 24 часа после контрольного заражения у вакцинированных рыб удаляли ткань селезенки (5 / группа). qRT-PCR выполняли в Eppendorf Mastercycler (Eppendorf, Гамбург, Германия) с набором SYBR Premix Ex Taq (Такара, Далянь, Китай), как описано ранее [30]. Внутренний референтный ген представлял собой субъединицу D РНК-полиназы II (RPSD) [37].О праймерах для qRT-PCR сообщалось ранее [38]. Анализ проводили трижды.

    Иммуноферментный анализ (ELISA)

    Сыворотки собирали у рыб (по 5 из каждой группы), вакцинированных pCN247, pCN523, pCN3 и PBS, через один месяц после вакцинации соответственно. Сыворотки серийно разводили в 2 раза в PBS, содержащем 1% бычий сывороточный альбумин (BSA). Анализ ELISA проводили, как сообщалось ранее [30]. Анализ проводили трижды.

    Цитотоксичность PBL

    Анализ выполняли с использованием набора для определения цитотоксичности {(анализ лактатдегидрогеназы (LDH)} (Roche Applied Science, Индианаполис, США) в соответствии с инструкциями производителя.Вкратце, целевые PBL получали из палтуса, инфицированного мегалоцивирусом RBIV-C1 в течение 5 дней, а эффекторные PBL получали из палтуса, вакцинированного pCN247, pCN523 или pCN3, как описано ранее [35]. Клетки суспендировали в среде L-15 (Invitrogen, Carlsbad, USA), содержащей 10% FBS. Эффекторные клетки смешивали с клетками-мишенями в соотношении 50: 1 в 96-луночном планшете для культивирования клеток. После инкубации при 24 ° C в течение 24 ч планшет центрифугировали и собирали бесклеточный супернатант.Аликвоты (100 мкл / лунку) супернатанта переносили в свежий 96-луночный планшет. Для определения активности ЛДГ в супернатанте в планшет добавляли равный объем свежеприготовленной реакционной смеси (из указанного выше набора). Планшет инкубировали в темноте при комнатной температуре в течение 30 мин и измеряли оптическую плотность при 492 нм. Цитотоксичность рассчитывали по следующей формуле: цитотоксичность (%) = (опытное значение — низкий контроль) / (высокий контроль — низкий контроль) × 100%. Анализ проводили трижды.

    Пролиферативная активность PBL

    PBL из палтуса, вакцинированного pCN247, pCN523 или pCN3, получали, как сообщалось ранее [35]. Клетки распределяли в 96-луночные планшеты для культивирования тканей (~ 1 × 10 5 клеток / лунку), содержащие среду L-15 (Invitrogen, Карлсбад, США) с 10% FBS и 1% пенициллина и стрептомицина. rP247, rP523 или ConA (Sigma-Aldrich, Сент-Луис, США) добавляли к клеткам до конечной концентрации 40 мкг / мл, 40 мкг / мл или 80 мкг / мл. К контрольным клеткам добавляли среду L-15.Клетки инкубировали при 24 ° C в течение 48 часов и добавляли 20 мкл 5 мг / мл МТТ {3- (4,5) -диметилтиахиазо (-z-y1) -3,5-ди-фенитетразолиумромид} (Sangon, Шанхай, Китай). После инкубации при 28 ° C в течение 4 ч в планшет добавляли 200 мкл ДМСО для растворения восстановленного формазана. Затем планшет считывали при 490 нм с помощью устройства для чтения микропланшетов. Индекс стимуляции определяли как кратное увеличение пролиферации клеток, обработанных антигеном, по сравнению с пролиферацией необработанных контрольных клеток. Анализ проводили трижды.

    РНК-интерференция (РНКи)

    1. Выбор эффективных миРНК. РНКи было выполнено с использованием технологии миРНК на основе ДНК-вектора. Чтобы выбрать миРНК с мешающим эффектом на экспрессию P247, три различных siРНК, нацеленных на P247, были вставлены в вектор экспрессии siRNA pRNAT-CMV3.1 (GenScript, Piscataway, США) на сайтах BamHI / AlfII, в результате чего были получены плазмиды psiP247–1, psiP247 –2 и psiP247–3. Точно так же три различных siRNA, нацеленных на P523, были вставлены в pRNAT-CMV3.1, в результате чего были получены плазмиды psiP523–1, psiP523–2 и psiP523–3. Кроме того, таким же образом была сконструирована плазмида psiCR, которая экспрессирует скремблируемую миРНК. Чтобы проверить эффективность этих плазмид siRNA, восемь групп палтуса (N = 5) инъецировали внутримышечно. с каждой из плазмид (20 мкг / рыбу) или с PBS. Через 2 дня после введения плазмиды рыб инфицировали внутрибрюшинно. инъекция мегалоцивируса RBIV-C1 (10 6 копий на рыбу). Через 5 дней после инфицирования селезенку отбирали в асептических условиях и исследовали на транскрипцию P247 и P523 с помощью qRT-PCR, как описано выше, с парами праймеров P247F3 / P247R3 и P523F3 / P523R3 соответственно (Таблица 1).Плазмиды с наиболее сильным ингибирующим действием на экспрессию P247 и P523 были переименованы в psiP247 и psiP523 соответственно. Этот скрининговый эксперимент проводился трижды. Последовательности миРНК, экспрессируемые psiP247, psiP523 и psiCR, представляют собой 5’-CGTTTGTAGCGTCTTGCAAA-3 ’, 5’-CGCACCACTAGATGCGGCCGA-3’ и 5’-CGACCGTCGCGTTAGCTGGTA3 ’соответственно.
    2. Влияние миРНК на репликацию вируса. Turbot вводили psiP247, psiP523, psiCR и PBS и заражали мегалоцивирусом RBIV-C1, как указано выше.Через 3 дня и 5 дней после заражения селезенку отбирали в асептических условиях и исследовали на вирусную нагрузку с помощью абсолютной количественной ПЦР в реальном времени, как сообщалось ранее [7]. Эксперимент проводился трижды.
    3. Влияние миРНК на экспрессию вирусных генов. Turbot вводили psiP247, psiP523, psiCR и PBS и заражали мегалоцивирусом RBIV-C1, как указано выше. Через 5 дней после заражения селезенку отбирали в асептических условиях и использовали для экстракции общей РНК, как описано выше.Затем определяли экспрессию 119 генов мегалоцивируса RBIV-C1 с помощью qRT-PCR, как указано выше, со специфическими праймерами [20]. Эксперимент проводился трижды.

    Статистический анализ

    Эксперименты проводились трижды. Статистический анализ проводился с помощью пакета SPSS 17.0 (SPSS Inc., Чикаго, Иллинойс, США). Для анализа смертности использовали критерий хи-квадрат с поправкой Йетса, а для всех других анализов использовали дисперсионный анализ (ANOVA).Во всех случаях уровень значимости был определен как P <0,05.

    Результаты

    Отбор генов мегалоцивирусов, кодирующих защитные иммуногены

    В предварительном скрининговом исследовании, чтобы идентифицировать гены мегалоцивируса с иммунопротекторным потенциалом, мы сконструировали 22 плазмиды ДНК-вакцины на основе 22 различных генов мегалоцивируса RBIV-C1. Защитный эффект этих вакцин исследовали на модели турбо. Результаты показали, что рыба, вакцинированная двумя вакцинными плазмидами, pCN247 и pCN523, показывала высокую выживаемость (более 60%).pCN247 и pCN523 были сконструированы на основе ORF107 и ORF86, соответственно, мегалоцитивируса RBIV-C1. ORF107 кодирует предполагаемый ядерный антиген из 247 аминокислотных остатков (названный P247), тогда как ORF86 кодирует гипотетический белок из 523 аминокислотных остатков (названный P523) без известной функции или структуры консервативного домена. Способность pCN247 и pCN523 экспрессировать гены вакцины в клетках рыб была подтверждена анализом IFA, который показал, что после трансфекции в клетки GF (линия клеток рыб) pCN247 и pCN523, но не контрольная плазмида pCN3, были способны экспрессировать кодируемые белки вакцины в трансфектантах (рис.1). С этими предварительными результатами мы выбрали pCN247 и pCN523 для дальнейшего изучения.

    Рис. 1. Непрямой иммунофлуоресцентный анализ экспрессии His-меченных P247 и P523 в клетках GF, трансфицированных pCN247 и pCN523.

    Трансфектанты pCN247 (A и B), pCN523 (D и E) и pCN3 (G и H) инкубировали с мышиным моноклональным антителом против His, а затем с меченным FITC козьим антителом против мыши. Клетки наблюдали под микроскопом с флуоресценцией (B, E и H) или без (A, D и G).Панели C, F и I являются объединением A и B, D и E, а также G и H соответственно. Увеличение, 25 × 5.

    https://doi.org/10.1371/journal.pone.0121282.g001

    Естественная продукция P247 и P523 у рыб, инфицированных мегалоцивирусом

    Перед дальнейшим изучением P247 и P523 мы проверили, действительно ли эти два белка экспрессируются мегалоцивирусом во время инфекции. С этой целью PBL от палтуса, инфицированного мегалоцивирусом, подвергали иммунофлуоресцентному анализу с использованием антител против рекомбинантных P247 и P523.Результаты показали, что при обнаружении P247 и P523 флуоресценция наблюдалась в PBL от инфицированных мегалоцивирусом рыб, но не в PBL от неинфицированных контрольных рыб (рис. 2), что позволяет предположить, что P247 и P523 действительно были продуцированы вирусом в зараженный хост.

    Рис. 2. Иммунофлуоресцентный анализ экспрессии P247 и P523 у рыб, инфицированных мегалоцивирусом.

    Лейкоциты периферической крови собирали из тюрбо, инфицированного (A, B, G и H) или без (D, E, J и K) мегалоцивируса.Клетки обрабатывали антителами крысы против рекомбинантного P247 (A, B, D и E) или P523 (G, H, J и K), а затем меченными FITC козьими антителами против крысы. Клетки наблюдали под микроскопом с флуоресценцией (B, E, H и K) или без (A, D, G и J). Панели C, F, I и L являются объединениями A и B, D и E, G и H, а также J и K соответственно. Увеличение 10 × 40.

    https://doi.org/10.1371/journal.pone.0121282.g002

    Вакцинация тюрбо pCN247 и pCN523

    1. Экспрессия вакцинных генов в тканях рыб. Для подтверждения иммунопротекторного потенциала pCN247 и pCN523, наблюдаемого при предварительном отборе, описанном выше, были проведены два испытания повторной вакцинации, в которых палтуса иммунизировали pCN247, pCN523, контрольным вектором pCN3 или PBS. Распределение плазмид ДНК-вакцины в тканях рыб определяли с помощью ПЦР через 7 дней после вакцинации. Результаты показали, что pCN247, pCN523 и pCN3 были обнаружены в почках, селезенке и мышцах рыб, вакцинированных соответствующими плазмидами, тогда как плазмиды не были обнаружены у рыб, вакцинированных PBS (S2, рис.и данные не показаны). Чтобы проверить, экспрессируются ли гены вакцины в тканях рыб, проводили ОТ-ПЦР для определения уровней мРНК P247 и P523 через 7 дней после вакцинации. Результаты показали, что транскрипты мРНК P247 и P523 были обнаружены в мышцах, почках и селезенке рыб, вакцинированных pCN247 и pCN523 соответственно, но не у рыб, вакцинированных pCN3 или PBS (фигура S2 и данные не показаны). Эти результаты показывают, что гены вакцины успешно экспрессировались в иммунизированных рыбах.
    2. Защита, индуцированная pCN247 и pCN523. Для проверки защитной эффективности pCN247 и pCN523 вакцинированных рыб заражали мегалоцивирусом через один месяц после вакцинации и отслеживали смертность и репликацию вируса в селезенке через 3 дня и 5 дней после заражения вирусом. Результаты показали, что по сравнению с рыбами, вакцинированными pCN3 и PBS, у рыб, вакцинированных pCN247 и pCN523, наблюдалась значительно сниженная вирусная нагрузка в оба момента времени (рис.3). Выживаемость рыб, вакцинированных pCN247, pCN523, pCN3 и PBS, составляла 75% (30/40), 63% (25/40), 0% и 0% соответственно (рис. 4). Основываясь на этих результатах, степени защиты в терминах RPS, индуцированные pCN247 и pCN523, составляли 75% и 63% соответственно с PBS в качестве контроля. Мегалоцивирус RBIV-C1 был обнаружен в почках, селезенке и печени умирающей рыбы, что подтвердило причину смерти от вирусной инфекции. Сравнимые уровни защиты (70% и 65% для pCN247 и pCN523 соответственно) были получены при испытании повторной вакцинации.

    Рис. 3. Репликация вируса у вакцинированных рыб.

    Turbot вакцинировали pCN247, pCN523, pCN3 или PBS (контроль) и заражали мегалоцитивирусом через один месяц после вакцинации. Вирусные нагрузки в селезенке определяли через 3 дня (A) и 5 ​​дней (B) после заражения. Данные представлены как средние значения ± SE (N = 3). N — количество раз, когда эксперимент проводился. ** P <0,01.

    https://doi.org/10.1371/journal.pone.0121282.g003

    Рис.4.Выживаемость вакцинированных рыб.

    Турботов, вакцинированных pCN3, pCN247, pCN523 и PBS (контроль), заражали мегалоцивирусом и ежедневно проверяли на выживаемость. Значимость между выживанием вакцинированной рыбы и контрольной рыбы определяли с помощью теста логарифмического ранга. ** P <0,01.

    https://doi.org/10.1371/journal.pone.0121282.g004

    Иммунный ответ, индуцированный pCN247 и pCN523

    1. Экспрессия иммунного гена. Через 24 часа после заражения вирусом была проведена qRT-PCR для определения экспрессии иммунных генов в селезенке. Исследуемые гены включают фактор некроза опухоли-α (TNF-α), миксовирус-резистентность (Mx), фактор усиления природных киллеров (NKEF), общий антиген лейкоцитов CD45, фактор регуляции интерферона (IRF) 1, IRF3, IRF5, IRF7, IRF8. , интерлейкин (IL) -1β, IL-8, IL-17, IL-22, преобразователь сигнала и активатор транскрипции 3 (STAT3), главный комплекс гистосовместимости (MHC) Iα, MHCIIα, иммуноглобулин (Ig) M и IgD.Результаты показали, что уровни экспрессии TNF-α, Mx, NKEF, CD45, IRF1, IRF3, IRF5, IRF7, IRF8, IL-17, IL-22, STAT3, MHCIα, MHCIIα и IgM у рыб, вакцинированных pCN247, были равны значительно активирована (рис. 5). Однако уровни экспрессии IL-1β, IL-8 и IgD были сравнимы с таковыми у рыб, вакцинированных pCN3 или PBS (данные не показаны). У рыб, вакцинированных pCN523, за исключением IL-1β, IL-8, IgD, NKEF и MHCIIα, все другие гены были активированы в значительной степени.
    2. Производство специфических сывороточных антител. Для исследования продукции антител в сыворотке крови собирали сыворотку у рыб, вакцинированных pCN247, pCN523, pCN3 или PBS, через месяц после вакцинации. Сыворотки разводили в разные стороны и подвергали анализу ELISA. Результаты показали, что для сывороток от рыб, вакцинированных pCN247, специфические антитела были обнаружены в 32-кратных и более низких разведениях, в то время как для сывороток от рыб, вакцинированных pCN523, специфические антитела были обнаружены в 64-кратных и более низких разведениях. (Рис. 6).У рыб, вакцинированных pCN3, не было обнаружено специфических сывороточных антител.
    3. Генерация цитотоксических иммунных клеток в PBL. Для изучения клеточного иммунного ответа, индуцированного pCN247 и pCN523, была оценена цитотоксичность PBL вакцинированных рыб. Для этой цели PBL собирали из палтуса, вакцинированного pCN247, pCN523, pCN3 или PBS. В последующем анализе LDH эти PBL служили эффекторными клетками и инкубировались с целевыми PBL из палтуса, инфицированного мегалоцивирусом.Результаты показали, что по сравнению с цитотоксической активностью PBL от рыб, вакцинированных PBS и pCN3, которые были сопоставимы, цитотоксическая активность PBL от рыб, вакцинированных pCN247 и pCN523, была значительно выше (рис. 7).
    4. Реакция PBL на вторичную стимуляцию антигеном. Чтобы изучить влияние вакцинации на продукцию иммунных клеток памяти, PBL из рыб, вакцинированных pCN247, pCN523, pCN3, обрабатывали rP247, rP523 или ConA, и пролиферативный ответ клеток измеряли с помощью анализа MTT.Результаты показали, что после обработки rP247 пролиферативная активность PBL от рыб, вакцинированных pCN247, была значительно увеличена по сравнению с таковой PBL от рыб, вакцинированных pCN3 (фиг. 8A). Напротив, после обработки ConA пролиферативная активность PBL у рыб, вакцинированных как pCN247, так и pCN3, повысилась до сопоставимых уровней. Точно так же обработка rP523 индуцировала значительно более высокую пролиферацию PBL у рыб, вакцинированных pCN523, чем в PBL у рыб, вакцинированных pCN3, тогда как обработка ConA не вызвала видимых различий в пролиферации PBL у рыб, вакцинированных pCN523 и pCN3 (рис.8Б).

    Рис. 5. Экспрессия иммунных генов у вакцинированных рыб.

    Turbot вакцинировали (контрольными) pCN247, pCN523 или pCN3 или без них и заражали мегалоцивирусом. Через 24 часа после заражения экспрессию иммунного гена в селезенке определяли с помощью количественной ОТ-ПЦР в реальном времени. Для удобства сравнения для каждого гена уровень мРНК контрольной рыбы был установлен равным 1. Данные представлены в виде средних значений ± стандартная ошибка (N = 3). N — количество раз, когда эксперимент проводился. ** P <0.01; * P <0,05.

    https://doi.org/10.1371/journal.pone.0121282.g005

    Рис. 6. Производство антител в сыворотке вакцинированной рыбы.

    Сыворотки собирали из палтуса, вакцинированного (контрольным) pCN247 или pCN523 или без него. Сыворотки разводили в разной степени и сывороточные антитела против rP247 и rP523 определяли с помощью ELISA. Данные представлены как средние значения ± стандартная ошибка (N = 3). N — количество раз, когда анализ был проведен. При каждом разведении значения между вакцинированной рыбой и контрольной рыбой указаны звездочкой.** P <0,01.

    https://doi.org/10.1371/journal.pone.0121282.g006

    Рис. 7. Цитотоксичность лейкоцитов периферической крови (PBL) вакцинированных рыб.

    PBL из палтуса, вакцинированного (контрольным) pCN247, pCN523 или pCN3, или без него, использовали в качестве эффекторных клеток, тогда как PBL из палтуса, инфицированного мегалоцивирусом, использовали в качестве клеток-мишеней. Эффекторные клетки и клетки-мишени смешивали и инкубировали в течение 24 часов. Цитотоксичность эффекторных клеток определяли с помощью анализа лактатдегидрогеназы.Данные представлены как средние значения ± стандартная ошибка (N = 3). N — количество раз, когда эксперимент проводился. ** P <0,01.

    https://doi.org/10.1371/journal.pone.0121282.g007

    Рис. 8. Пролиферативная активность лейкоцитов периферической крови (PBL) вакцинированных рыб в ответ на стимуляцию антигеном.

    PBL из палтуса, вакцинированного pCN247, pCN523 или pCN3, обрабатывали с (контрольным) rP247, rP523 или ConA или без него, и клеточную пролиферацию определяли с помощью анализа МТТ.Индекс стимуляции определяли как кратное увеличение пролиферации клеток, обработанных антигеном, по сравнению с пролиферацией необработанных контрольных клеток. Данные представлены как средние значения ± стандартная ошибка (N = 3). N — количество раз, когда эксперимент проводился. ** P <0,01.

    https://doi.org/10.1371/journal.pone.0121282.g008

    Возможная роль P247 и P523 в вирусной инфекции

    1. P247 и P523 Нокдаун. На данный момент наши результаты показывают, что P247 и P523 в форме ДНК-вакцины индуцируют защитный иммунитет против мегалоцивируса.Основываясь на этих результатах, мы предположили, что P247 и P523, функции которых как вирусные компоненты были полностью неизвестны, возможно, могут быть важными факторами в репликации вируса. Чтобы исследовать эту гипотезу, мы исследовали влияние нокдауна P247 и P523 на мегалоцивирусную инфекцию. Для этой цели были сконструированы плазмиды psiP247 и psiP523, которые были сконструированы для экспрессии in vivo P247- и P523-специфичных siRNA соответственно. В качестве контроля также была создана плазмида psiCR, которая экспрессирует неспецифическую миРНК.Чтобы изучить мешающую эффективность siRNA, палку, вводимую с или без psiP247, psiP523 или psiCR, инфицировали мегалоцивирусом, а экспрессию P247 и P523 определяли с помощью qRT-PCR через 5 дней после инфицирования. Результаты показали, что экспрессия P247 у рыб, содержащих psi247, была значительно ( P <0,01) снижена до уровня 54% от уровня контрольной рыбы. Аналогичным образом, уровень экспрессии P523 у рыб, содержащих psi523, был значительным ( P <0.01) снизился до 41% по сравнению с контрольной рыбой. Напротив, уровни экспрессии P247 и P523 у рыб, которым вводили psiCR, были сравнимы с таковыми у контрольных рыб. Эти результаты показывают, что psiP247 и psiP523 эффективно снижали экспрессию P247 и P523 соответственно.
    2. Эффект нокдауна P247 и P523 на репликацию вируса. Чтобы изучить влияние нокдауна P247 и P523 на репликацию вируса, палтус, введенный с psiP247, psiP523, psiCR или PBS, инфицировали мегалоцивирусом, и вирусную нагрузку в селезенке определяли через 3 дня и 5 дней после инфицирования.Результаты показали, что присутствие psiP247 и psiP523 значительно снижало количество вирусов в оба момента времени, тогда как присутствие psiCR не оказывало заметного влияния на репликацию вирусов (рис. 9).
    3. Эффект нокдауна P247 и P523 на экспрессию вирусных генов в глобальном масштабе. С приведенным выше результатом, который показал, что вмешательство в экспрессию P247 и P523 влияет на репликацию вируса, мы задались вопросом, будет ли нарушение регуляции P247 и P523 каким-либо образом влиять на экспрессию вирусных генов в глобальном масштабе.Чтобы исследовать этот вопрос, мы провели анализ транскриптома всего генома, чтобы изучить эффект нокдауна P247 и P523 на экспрессию всех предполагаемых генов мегалоцивируса RBIV-C1, представленных 119 открытыми рамками считывания, идентифицированными в геноме вируса. Результаты показали, что по сравнению с контрольной рыбой, рыба, которой вводили psiP247, показала значительные ( P <0,01) изменения (от 2,8 до 16 раз) в экспрессии 26 генов, все из которых подавлялись (фиг.10; таблица 2). .Из этих генов три (ORF 18L, 34L и 51L) являются предполагаемыми белками оболочки, один (ORF 74L) - протеинкиназами / фосфатазами, три (ORF 16R, 113L и 116L) - регуляторными белками, три (ORF 21R, 47L). , и 83R) связаны с репликацией ДНК, две (ORF 63L и 72R) участвуют в транскрипции РНК. Остальные 14 генов с пониженной регуляцией (ORF 17L, 22L, 28L, 41L, 46L, 52L, 65L, 66R, 77L, 78R, 82L, 90L, 100R и 102L) неизвестны. У рыб, которым вводили psiP523, значимое ( P <0.01) наблюдались изменения (от 2,6 до 44 раз) в экспрессии 41 гена, включая 39 генов с пониженной регуляцией и 2 гена с повышенной регуляцией (рис. 10; таблица 2). Из генов с пониженной регуляцией два (ORF 18L и 19R) являются предполагаемыми белками оболочки, четыре (ORF 6L, 24L, 55L и 74L) являются протеинкиназами / фосфатазами, три (ORF 16R, 98R и 106L) являются регуляторными. белков, один (ORF 13R) - это убиквитинлигазы, два (ORF 44L и 105R) - функциональные ферменты, три (ORF 21R, 29L и 47L) связаны с репликацией ДНК, один (ORF 35R) связан с транскрипцией РНК и три (ORF 2L, 25R и 59L) участвуют в пролиферации клеток.Остальные 20 генов с пониженной регуляцией (ORF 9R, 11L, 15R, 17L, 23L, 27R, 38L, 39L, 42L, 46L, 48R, 52L, 53R, 54L, 57L, 58L, 72R, 81R, 82L и 103L) неизвестны по функциям. И два гена с повышенной регуляцией (ORF 75R и 113L) связаны с активностью регуляции клеток.

    Рис. 9. Эффект нокдауна P247 и P523 на вирусную инфекцию.

    Turbot, которым вводили PBS (контроль), psiP247, psiP523 или psiCR инфицировали мегалоцивирусом, и количество вируса в селезенке определяли через 3 дня (A) и 5 ​​дней (B) после заражения.Данные выражены как среднее значение ± стандартная ошибка (N = 3). N — количество раз, когда эксперимент проводился. ** P <0,01.

    https://doi.org/10.1371/journal.pone.0121282.g009

    Рис. 10. Влияние нокдауна P247 и P523 на экспрессию вирусных генов в глобальном масштабе.

    Turbot, которым вводили psiP247 (A), psiP523 (B) или psiCR (контроль), инфицировали мегалоцивирусом, и экспрессию 119 вирусных генов в селезенке определяли количественной ОТ-ПЦР в реальном времени.

    https://doi.org/10.1371/journal.pone.0121282.g010

    Обсуждение

    В этом исследовании мы изучили потенциал вакцины для набора генов мегалоцивирусов в качестве ДНК-вакцин, основываясь на знании того, что ДНК-вакцина обладает уникальной особенностью стимулирования как гуморальных, так и клеточных иммунных ответов, которые важны для контроля вирусных инфекций. болезни [39–41]. Из 22 исследованных вирусных генов два гена, экспрессированные из вакцинных плазмид pCN247 и pCN523, индуцировали эффективную защиту.Для ДНК-вакцин одно из основных требований состоит в том, чтобы гены вакцины экспрессировались в целевом хозяине. В нашем исследовании иммунофлуоресцентная микроскопия показала, что клетки рыб, трансфицированные pCN247 и pCN523, способны продуцировать рекомбинантные P247 и P523 соответственно, что позволяет предположить, что экзогенные гены вакцины экспрессируются в трансфектантах. В соответствии с этим наблюдением, pCN247 и pCN523 были локализованы во многих тканях после вакцинации палтуса, а экспрессия P247 и P523 в тканях была обнаружена с помощью qRT-PCR.Эти результаты аналогичны тем, которые наблюдались в предыдущих исследованиях ДНК-вакцин рыб [23,28,42–44], которые показывают, что ДНК-вакцины, продиктованные промотором млекопитающих, могут успешно экспрессироваться в костистых животных через систему транскрипции и трансляции хозяина. Анализ защиты показал, что после заражения мегалоцивирусом палтус, вакцинированный pCN247 и pCN523, демонстрировал значительно сниженную вирусную нагрузку, предполагая, что pCN247 и pCN523 должны были вызывать определенные иммунные ответы, которые ингибировали репликацию вируса.В соответствии с этими наблюдениями, pCN247 и pCN523 обеспечили степень защиты более 63%, что поразительно, учитывая тот факт, что совокупная смертность контрольной рыбы составила 100%. Эти результаты показывают, что pCN247 и pCN523 являются кандидатами в вакцины с высокой защитой. Хотя тест на защиту проводился с палтусом, результаты могут быть применены к другим костистым видам. Подобно большинству исследований вакцины против рыб, в которых обычно задействовано гораздо большее количество животных, чем в исследованиях сородичей с млекопитающими, количество животных, используемых в нашем испытании вакцинации, было относительно большим.В будущих исследованиях количество экспериментальной рыбы может быть уменьшено, чтобы свести к минимуму убийство животных.

    У млекопитающих клеточно-опосредованная цитотоксичность, при которой инфицированные вирусом клетки распознаются и лизируются эффекторными клетками иммунной системы, является жизненно важным механизмом в борьбе с вирусными инфекциями [45,46]. У рыб были идентифицированы CD8 (+) цитотоксические Т-лимфоциты (CTL), аналогичные таковым систем млекопитающих, и есть доказательства, указывающие на существование клеточно-опосредованного иммунитета [47–49].Сообщалось, что PBL, выделенные из радужной форели, вакцинированной ДНК-вакциной, кодирующей G-белок VHSV, демонстрировали повышенное количество CTL, и что PBL из радужной форели, сублетально инфицированной VHSV, убивали MHC класса I, соответствовали, а также были ксеногенными. VHSV-инфицированные клетки, несоответствующие классу I MHC [50,51]. В исследованиях с красным морским лещом клеточно-опосредованная цитотоксичность была важна для предотвращения заражения иридовирусом красного морского леща (RSIV) [29]. В нашем исследовании мы обнаружили, что PBL из рыб, вакцинированных pCN247 и pCN523, обладают значительно повышенной цитотоксической активностью в отношении клеток рыб, инфицированных мегалоцивирусом, что позволяет предположить, что вакцинация pCN247 и pCN523 вызывала клеточно-опосредованный иммунитет, который генерировал CTL, нацеленные на мегалоцивирус.В соответствии с этим наблюдением, анализ пролиферации показал, что по сравнению с PBL от контрольной рыбы, PBL от рыб, вакцинированных pCN247 и pCN523, проявляли аналогичные уровни ответа на стимуляцию ConA, но значительно более сильный ответ на стимуляцию rP247 и rP523. Эти результаты предполагают, что вакцинация индуцирует продукцию P247- и P523-специфических клеток памяти в PBL, которые распознают и активируются специфическими антигенами при вторичном контакте.

    Предыдущие исследования показали, что ДНК-вакцины рыб способствуют экспрессии иммунных генов способом, который зависит от вакцины и животного-мишени [24,52–55].В этом исследовании qRT-PCR показала, что у рыб, вакцинированных как pCN247, так и pCN523, была значительно повышена экспрессия генов врожденного и адаптированного иммунитета, включая те, которые, как известно, участвуют в противовирусном ответе (серии Mx, NKEF и IRF), что, вероятно, частично объясняет снижение вирусной нагрузки, наблюдаемое у вакцинированных рыб. В соответствии со значительно повышенной экспрессией IgM у рыб, вакцинированных pCN247 и pCN523, у этих рыб были обнаружены специфические сывороточные антитела.Эти результаты показывают, что pCN247 и pCN523 вызывают как гуморальный, так и клеточный иммунные ответы у камбалы.

    Накапливающиеся данные показали, что siRNA может специфически и эффективно ингибировать ряд вирусов, включая вирус иммунодефицита человека [56], вирус Западного Нила [57], вирус японского энцефалита [58] и вирус гриппа [59]. Сходным образом, в настоящем исследовании мы обнаружили, что siRNA, экспрессируемая из psiP247 и psiP523, эффективно снижала экспрессию P247 и P523, соответственно, до уровней, сопоставимых с уровнями, о которых сообщалось ранее у других видов костистых [60–63].В отличие от наблюдений, проведенных на млекопитающих, в которых siRNA может вызывать очень высокий уровень ингибирования экспрессии генов-мишеней, эффективность siRNA при костистых костях обычно составляет около 40% -60% [60,61,64]. Тем не менее, значительные эффекты могут быть получены в результате относительно умеренной РНК-интерференции [60–64]. В нашем исследовании in vivo инфекция показала, что нокдаун P247 и P523 значительно нарушает репликацию вируса в тканях рыб, предполагая, что нормальная экспрессия P247 и P523 имеет важное значение для вирусной инфекции.Эти результаты не противоречат результатам вакцинации pCN247 и pCN523. В последнем случае вакцинация pCN247 и pCN523 привела к продукции P247 и P523 у рыб по крайней мере через 7 дней после вакцинации, что позволило вызвать иммунный ответ хозяина, такой как образование CTL и антител, специфичных к P247 и P523, как указано. над. Когда рыбу заражали вирусом через месяц после вакцинации, экспрессируемые вирусом P247 и P523 распознавались и блокировались в своей функции иммунными факторами хозяина (например,грамм. антитела, которые нейтрализуют P247 и P523), и инфицированные вирусом клетки-хозяева, экспрессирующие P247 и P523, были убиты специфическими CTL. В результате общая репликация вируса была снижена. В соответствии с этими наблюдениями, анализ транскрипции всего генома показал, что нокдаун P247 и P523 изменяет экспрессию большого количества вирусных генов. Примечательно, что все 26 генов, затронутых нокдауном P247, были подавлены; аналогичным образом подавлялась регуляция большинства генов, модулируемых P523. Эти результаты показывают, что в нормальных условиях P247 и P523 необходимы для оптимальной экспрессии этих «целевых» генов, что предполагает прямую или косвенную стимулирующую роль P247 и P523 в отношении экспрессии этих генов.Поскольку затронутые гены охватывают основные аспекты репликации вируса (синтез белка оболочки, репликация ДНК, транскрипция РНК и т. Д.), Их ослабленная экспрессия неизбежно ухудшает вирусную инфекцию.

    В заключение, в этом исследовании мы идентифицировали два белка мегалоцивируса, P247 и P523, которые в форме ДНК-вакцин вызывают эффективный защитный иммунитет. Наши результаты указывают на производство цитотоксических и иммунных клеток памяти и, таким образом, на участие специфической клеточной защиты у рыб, вакцинированных P247 и P523, что позволяет лучше понять иммунный механизм ДНК-вакцин у костистых рыб.Кроме того, мы демонстрируем, что P247 и P523 играют фундаментальную роль, необходимую для репликации вируса, что способствует нашему пониманию инфекции мегалоцивируса и впервые предполагает связь между защитной способностью вирусных иммуногенов и их биологическим значением в репликации вируса.

    Дополнительная информация

    S1 Рис. SDS-PAGE очищенного рекомбинантного P247 (соответствует положениям 47–217) (дорожка 2) и P523 (соответствует положениям 115–305) (дорожка 3).

    Очищенные белки анализировали с помощью SDS-PAGE и просматривали после окрашивания бриллиантовым синим кумасси R-250. Дорожка 1, белковые маркеры.

    https://doi.org/10.1371/journal.pone.0121282.s001

    (TIF)

    S2 Рис. Наличие вакцинных плазмид (A) и экспрессия генов, кодирующих вакцину (B), в тканях рыб.

    (A) Турботов вакцинировали pCN3 (дорожка 2), pCN523 (дорожка 4), pCN247 (дорожка 6) и PBS (дорожки 3, 5 и 7). Через 7 дней после вакцинации ДНК экстрагировали из селезенки и использовали для ПЦР с праймерами, специфичными для pCN3 (дорожки 2 и 3), pCN523 (дорожки 4 и 5) и pCN247 (дорожки 6 и 7).(B) Турботов вакцинировали pCN523 (дорожка 2), pCN247 (дорожка 5), pCN3 (дорожки 3 и 6) и PBS (дорожки 4 и 7). Через 7 дней после вакцинации РНК экстрагировали из селезенки и использовали для ОТ-ПЦР с праймерами, специфичными для плазмидного происхождения P523 (дорожки 2, 3 и 4 верхней панели), P247 (дорожки 5, 6 и 7 из верхняя панель) или, в качестве внутреннего контроля, с праймерами, специфичными для субъединицы D РНК-полиназы II (RPSD) (нижняя панель). Дорожка 1 на обеих панелях, маркеры молекулярной массы ДНК.

    https: // doi.org / 10.1371 / journal.pone.0121282.s002

    (TIF)

    Вклад авторов

    Задумал и спроектировал эксперименты: LS JZ. Проведены эксперименты: JZ. Проанализированы данные: JZ BCZ. Написал статью: LS JZ.

    Ссылки

    1. 1. Чинчар В.Г., Эссбауэр С., Хе Дж. Г., Хаятт А., Миядзаки Т., Селиги В. и др. Часть II. Двухцепочечные ДНК-вирусы, семейство Iridoviridae. В: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA (eds) Virus taxonomy, VIIIth Report of the International Committee on taxonomy of virus.Elsevier / Academic Press. 2005; С. 145–162.
    2. 2. Уиттингтон Р.Дж., Беккер Дж.А., Деннис ММ. Иридовирусные инфекции в критическом обзоре для рыб с упором на ранавирусы. J Fish Dis. 2010. 33: 95–122. pmid: 20050967
    3. 3. Курита Дж, Накадзима К. Мегалоцитивирусы. Вирусы-Базель. 2012; 4: 521–538.
    4. 4. Он Дж. Г., Вен С. П., Цзэн К., Хуанг З. Дж., Чан С. М.. Системное заболевание, вызванное иридовирусоподобным агентом у культивируемых мандаринок, Siniperca chuatsi (Basilewsky), в Китае.J Fish Dis. 2000. 23: 219–222.
    5. 5. Чен XH, Лин КБ, Ван XW. Вспышки иридовирусной болезни у крупного желтого горбыля, выращиваемого в марикультуре, Larimichthys crocea (Richardson) в Китае. J Fish Dis. 2003. 26: 615–619. pmid: 14653319
    6. 6. Ши CY, Ван Ю.Г., Ян С.Л., Хуанг Дж., Ван ЦЙ. Первое сообщение о заражении иридовирусоподобным агентом у выращиваемой камбалы Scophthalmus maximus в Китае. Аквакультура. 2004; 236: 11–25.
    7. 7. Чжан М., Сяо Цзы, Ху Ю., Сунь Л.Характеристика мегалоцивируса культивируемого морского леща Oplegnathus fasciatus (Temminck & Schlege) в Китае. Aquac Res. 2012; 43: 556–564.
    8. 8. Каваками Х., Накадзима К. Культурные виды рыб, пораженные иридовирусной болезнью красного морского леща с 1996 по 2000 год. Fish Pathol. 2002; 37: 45–47.
    9. 9. Ван Ч.С., Ши Х.Х., Ку CC, Чен С.Н. Исследования эпизоотической иридовирусной инфекции среди красного морского леща Pagrus major (Temminck & Schlegel), выращиваемого на Тайване.J Fish Dis. 2003. 26: 127–133. pmid: 12962222
    10. 10. Синмото Х., Танигучи К., Икава Т., Каваи К., Осима С. Фенотипическое разнообразие изолятов инфекционного иридовируса красного морского леща, выращенных в Японии. Appl Environ Microb. 2009. 75: 3535–3541. pmid: 19346349
    11. 11. Ким WS, О MJ, Юнг SJ, Ким YJ, Китамура SI. Характеристика иридовируса, обнаруженного в культуре камбалы Scophthalmus maximus в Корее. Dis Aquat Organ. 2005. 64: 175–180. pmid: 15918481
    12. 12.До JW, Cha SJ, Kim JS, An EJ, Lee NS, Choi HJ и др. Филогенетический анализ основного гена капсидного белка изолятов иридовируса из культивируемых камбал Paralichthys olivaceus в Корее. Dis Aquat Organ. 2005; 64: 193–200. pmid: 15997817
    13. 13. Jeong JB, Kim HY, Kim KH, Chung JK, Komisar JL, Jeong HD. Молекулярное сравнение иридовирусов, выделенных из морских рыб, выращиваемых в Корее и импортированных из Китая. Аквакультура. 2006. 255: 105–116.
    14. 14.Ли Н.С., До Дж. У., Пак Дж. У., Ким Ю. Характеристика распространения вируса у леща ( Oplegnathus fasciatus ; Temminck and Schlegel), инфицированного мегалоцивирусом. J Comp Pathol. 2009. 141: 63–69. pmid: 19477463
    15. 15. He JG, Deng M, Weng SP, Li Z, Zhou SY, Long QX и др. Полный анализ генома иридовируса инфекционного некроза селезенки и почек мандаринов. Вирусология. 2001. 291: 126–139. pmid: 11878882
    16. 16. Курита Дж., Накадзима К., Хироно И., Аоки Т.Полное секвенирование генома иридовируса красного морского леща (RSIV). Рыболовство. 2002; 68: 1113–1115.
    17. 17. До JW, Moon CH, Kim HJ, Ko MS, Kim SB, Son GH и др. Полная последовательность геномной ДНК иридовируса леща. Вирусология. 2004. 325: 351–363. pmid: 15246274
    18. 18. Лу Л., Чжоу С.Ю., Чен С., Вен С.П., Чан С.М., Хе Дж. Полный анализ последовательности генома иридовируса, выделенного из оранжевого окуня, Epinephelus coioides . Вирусология. 2005; 339: 81–100.pmid: 15964605
    19. 19. Shi CY, Jia KT, Yang B, Huang J. Полная последовательность генома мегалоцивируса (семейство Iridoviridae), связанного со смертностью камбалы в Китае. Вирол Дж. 2010; 7: 159. pmid: 20630106
    20. 20. Zhang BC, Zhang M, Sun BG, Fang Y, Xiao ZZ, Sun L. Полная последовательность генома и профили транскрипции иридовируса леща RBIV-C1. Dis Aquat Organ. 2013; 104: 203–214. pmid: 23759558
    21. 21. Lorenzen N, LaPatra SE. ДНК-вакцины для аквакультурных рыб.Rev Sci Tech. 2013; 24: 201–213.
    22. 22. Тонхейм TC, Богвальд Дж., Далмо РА. Что происходит с ДНК-вакциной у рыб? Обзор текущих знаний. Fish Shellfish Immunol. 2008; 25: 1–18. pmid: 18448358
    23. 23. Куэста А., Чавес-Позо Э., де лас Херас А.И., Сен-Жан С.Р., Перес-Прието С., Тафалла С. Активная ДНК-вакцина против вируса инфекционного некроза поджелудочной железы (IPNV) с другим механизмом действия, чем ДНК-вакцины рабдовируса рыб. Вакцина. 2010. 28: 3291–3300.pmid: 20226245
    24. 24. Куэста А., Тафалла С. Транскрипция иммунных генов при заражении вирусом вирусной геморрагической септицемии (VHSV) у вакцинированной ДНК радужной форели ( Oncorhynchus mykiss ). Вакцина. 2009. 27: 280–289. pmid: 18977266
    25. 25. Чжоу JX, Ван Х., Ли XW, Чжу X, Лу В.Л., Чжан DM. Конструирование ДНК-вакцины KHV-CJ ORF25 и иммунный тест. J Fish Dis. 2014; 37: 319–325. pmid: 23962282
    26. 26. de las Heras AI, Saint-Jean SR, Perez-Prieto SI.Иммуногенные и защитные эффекты пероральной ДНК-вакцины против вируса инфекционного некроза поджелудочной железы у рыб. Fish Shellfish Immunol. 2010. 28: 562–570. pmid: 20034576
    27. 27. Гарвер К.А., ЛаПатра С.Е., Курат Г. Эффективность вакцины ДНК вируса инфекционного гематопоэтического некроза (IHN) у чавычи , Oncorhynchus tshawytscha и нерки , лосося O-nerka . Dis Aquat Organ. 2005; 64: 13–22. pmid: 15

      3

    28. 28. Микалсен А.Б., Синдре Х., Торгерсен Дж., Римстад Э.Защитные эффекты ДНК-вакцины, экспрессирующей гемагглютинин-эстеразу вируса инфекционной анемии лосося, у атлантического лосося . Вакцина. 2005; 23: 4895–4905. pmid: 16005119
    29. 29. Caipang CMA, Takano T, Hirono T., Aoki T. Генетические вакцины защищают красного морского леща, Pagrus major , при заражении иридовирусом красного морского леща (RSIV). Fish Shellfish Immunol. 2006. 21: 130–138. pmid: 16359871
    30. 30. Zhang M, Hu YH, Xiao ZZ, Sun Y, Sun L. Создание и анализ экспериментальных ДНК-вакцин против мегалоцивируса.Fish Shellfish Immunol. 2012; 33: 1192–1198. pmid: 22986024
    31. 31. Jiao XD, Zhang M, Hu YH, Sun L. Создание и оценка ДНК-вакцин, кодирующих антигенов Edwardsiella tarda . Вакцина. 2009. 27: 5195–5202. pmid: 19596416
    32. 32. Ху YH, Zheng WJ, Sun L. Идентификация и молекулярный анализ субъединицы ферритина из красного барабана ( Sciaenops ocellatus ). Fish Shellfish Immunol. 2010. 28: 678–686. pmid: 20064620
    33. 33.Чжан Дж, Ху Y, Сяо З., Сунь Л. Белки камбалы, индуцированные мегалоцивирусом ( Scophthalmus maximus ): идентификация и противовирусный потенциал. J Proteomics. 2013; 91: 430–443. pmid: 23933595
    34. 34. Сунь К., Чжан В.В., Хоу Дж.Х., Сун Л. Иммунопротекторный анализ VhhP2, кандидата на вакцину Vibrio harveyi . Вакцина. 2019; 27: 2733–2740.
    35. 35. Zhou ZX, Zhang J, Sun L. C7: CpG-олигодезоксинуклеотид, который индуцирует защитный иммунный ответ против мегалоцивируса у японской камбалы ( Paralichthys olivaceus ) через сигнальный путь, опосредованный toll-подобным рецептором 9.Dev Com Immunol. 2014; 44: 124–132.
    36. 36. Ли М.Ф., Чжан Б., Ли Дж., Сун Л. Сил: бактериоцин Streptococcus iniae с двойной ролью антимикробного средства и иммуномодулятора, который подавляет врожденный иммунный ответ и способствует развитию S . iniae инфекция. Plos ONE. 2014; 9: e96222. pmid: 24781647
    37. 37. Zhang J, Hu YH, Sun BG, Xiao ZZ, Sun L. Выбор коэффициентов нормализации для количественных исследований RT-PCR в реальном времени у японской камбалы ( Paralichthys olivaceus ) и камбалы ( Scophthalmus maximus ) в условиях вирусной инфекции.Вет Иммунол Иммуноп. 2013; 152: 303–316. pmid: 23332581
    38. 38. Лю С.С., Сунь Й., Ху Ю.Х., Сан Л. Идентификация и анализ мотива CpG, который защищает камбалу ( Scophthalmus maximus ) от бактериального заражения и усиливает индуцированный вакциной специфический иммунитет. Вакцина. 2010. 28: 4153–4161. pmid: 20416262
    39. 39. Уиттон Дж. Л., Родригес Ф., Чжан Дж., Хассетт ДЭ. ДНК-иммунизация: механистические исследования. Вакцина. 1999; 17: 1612–1619. pmid: 10194813
    40. 40.Evensen O, Leong JAC. ДНК-вакцины против вирусных болезней разводимых рыб. Fish Shellfish Immunol. 2013; 35: 1751–1758. pmid: 24184267
    41. 41. Сальгадо-Миранда С., Лоза-Рубио Е., Рохас-Анайя Е., Гарсия-Эспиноза Г. Вирусные вакцины для костистых рыб: прошлое, настоящее и будущее. Экспертные ревакцины. 2013; 12: 567–578. pmid: 23659303
    42. 42. Hu YH, Sun L. Бивалентная ДНК-вакцина Vibrio harveyi вызывает сильную защиту у японской камбалы ( Paralichthys olivaceus ).Вакцина. 2011; 29: 4328–4333. pmid: 21513763
    43. 43. Sun Y, Liu CS, Sun L. Сравнительное исследование иммунного эффекта антигена Edwardsiella tarda в двух формах: субъединичная вакцина против ДНК-вакцины. Вакцина. 2011; 29: 2051–2057. pmid: 21255681
    44. 44. de las Heras AI, Prieto SIP, Saint-Jean SR. In vitro и in vivo иммунных ответов, индуцированных ДНК-вакциной, кодирующей ген VP2 вируса инфекционного некроза поджелудочной железы.Fish Shellfish Immunol. 2009. 27: 120–129. pmid: 19121400
    45. 45. Pamer E, Cresswell P. Механизмы MHC класса I — ограниченный процессинг антигена. Анну Рев Иммунол. 1998. 16: 323–358. pmid: 9597133
    46. 46. Депутат Weekes, MR Уиллс, Майнард К., Кармайкл А.Дж., Sissons JGP. Ответ цитотоксических Т-лимфоцитов (CTL) памяти на инфекцию цитомегаловируса человека содержит отдельные пептид-специфические клоны CTL, которые подверглись обширной экспансии in vivo . J Virol.1999; 73: 2099–2108. pmid: 9971792
    47. 47. Наканиси Т., Тода Х., Шибасаки Ю., Сомамото Т. Цитотоксические Т-клетки костистых рыб. Dev Comp Immunol. 2011; 35: 1317–1323. pmid: 21530578
    48. 48. Fischer U, Koppang EO, Nakanishi T. Teleost T- и NK-клеточный иммунитет. Fish Shellfish Immunol. 2013; 35: 197–206. pmid: 23664867
    49. 49. Чавес-Посо Э., Гвардиола Ф.А., Месегер Дж., Эстебан М.А., Куэста А. Инфекция, вызванная нодавирусом, вызывает сильную врожденную клеточно-опосредованную цитотоксическую активность у резистентных, дорады морского леща и восприимчивых европейских морских окуней, костистых рыб.Fish Shellfish Immunol. 2012; 33: 1159–1166. pmid: 22981914
    50. 50. Утке К., Кок Х., Шуэтце Х., Бергманн С.М., Лоренцен Н., Эйнер-Йенсен К. и др. Клеточно-опосредованные иммунные ответы у радужной форели после иммунизации ДНК против вируса вирусной геморрагической септицемии. Dev Comp Immunol. 2008. 32: 239–252. pmid: 17629943
    51. 51. Утке К., Бергманн С., Лоренцен Н., Коллнер Б., Ототаке М., Фишер У. Клеточно-опосредованная цитотоксичность у радужной форели, Oncorhynchus mykiss , инфицированная вирусом вирусной геморрагической септицемии.Fish Shellfish Immunol. 2007. 22: 182–196. pmid: 16784874
    52. 52. Byon JY, Ohira T., Hirono I., Aoki T. Использование микроматрицы кДНК для изучения иммунитета против вирусной геморрагической септицемии (VHS) у японской камбалы ( Paralichthys olivaceus ) после вакцинации ДНК. Fish Shellfish Immunol. 2005. 18: 135–147. pmid: 15475310
    53. 53. Кастро Р., Мартинес-Алонсо С., Фишер У., де Аро Н.А., Сото-Лампе В., Ван Т. и др. ДНК-вакцинация против рабдовируса рыб способствует раннему рекрутированию В-клеток, связанных с хемокинами, в мышцы.Вакцина. 2014. 32: 1160–1168. pmid: 24291197
    54. 54. Санчес Э., Колл Дж., Тафалла С. Экспрессия индуцибельных CC-хемокинов в радужной форели ( Oncorhynchus mykiss ) в ответ на ДНК-вакцину вируса геморрагической септицемии (VHSV) и интерлейкин 8. Dev Comp Immunol. 2007; 31: 916–926. pmid: 17284335
    55. 55. Перейро П., Диос С., Болтана С., Колл Дж., Эстепа А., Маккензи С. и др. Профили транскриптомов, связанные с VHSV-инфекцией или ДНК-вакцинацией камбалы ( Scophthalmus maximus ).Plos One. 2014; 9: e104509. pmid: 25098168
    56. 56. Huelsmann PM, Rauch P, Allers K, John MJ, Metzner KJ. Ингибирование лекарственно-устойчивого ВИЧ-1 посредством РНК-интерференции. Antiviral Res. 2006; 69: 1–8. pmid: 162

    57. 57. Энтони К.Г., Бай Ф.В., Кришнан М.Н., Фикриг Э., Коски Р.А. Эффективное нацеливание siRNA на 3′-нетранслируемую область генома вируса Западного Нила. Antiviral Res. 2009. 82: 166–168. pmid: 19135091
    58. 58. Мураками М., Ота Т., Нукузума С., Такегами Т.Ингибирующее действие РНКи на репликацию вируса японского энцефалита in vitro и in vivo . Microbiol Immunol. 2005; 49: 1047–1056. pmid: 16365529
    59. 59. Ge Q, Eisen HN, Chen JZ. Использование миРНК для профилактики и лечения вирусной инфекции гриппа. Virus Res. 2004. 102: 37–42. pmid: 15068878
    60. 60. Dong ZQ, Peng JS, Guo S. Стабильное молчание генов у рыбок данио с пространственно-временным нацеливанием РНК-интерференции. Генетика. 2013; 193: 1065–1071.pmid: 23378068
    61. 61. Ван В.Л., Лю В.Т., Гонг Х.Й., Хун-младший, Лин С.К., Ву Ю.Л. Активация экспрессии цитокинов происходит через TNF-альфа / NF-каппа B-опосредованный путь в клетках, инфицированных бирнавирусом. Fish Shellfish Immunol. 2011; 31: 10–21. pmid: 21272652
    62. 62. Сяо Ю.М., Чжоу Ю.Х., Сюн З., Цзоу Л.Дж., Цзян М.Г., Ло З. и др. Участие JNK в эмбриональном развитии и органогенезе у рыбок данио. Mar Biotechnol. 2013; 15: 716–725. pmid: 23884438
    63. 63.Чжу Р., Ван Дж., Лей XY, Гуй Дж. Ф., Чжан Цюй. Доказательства противовирусного эффекта Paralichthys olivaceus IFITM1, препятствующего проникновению вируса в клетки-мишени. Fish Shellfish Immunol. 2013; 35: 918–926. pmid: 23850425
    64. 64. Zhou ZX, Zhang J, Sun L. C7: олигодезоксинуклеотид CpG, который индуцирует защитный иммунный ответ против мегалоцивируса у японской камбалы (Paralichthys olivaceus) через сигнальный путь, опосредованный toll-подобным рецептором 9. Dev Comp Immunol. 2004. 44: 124–132.

    Характеристика нового мегалоцивируса, выделенного из европейского голавля (Squalius cephalus) — Профили экспертов по исследованиям в области здравоохранения UTMB

    @article {e4dd1b33c8454c4db5285bd4e6293e27,

    title = «Характеристика нового мегалоциубируса 9000, выделенного из европеоидного хищника Squalocyubhal11 (9000) = «Новый вирус от умирающего европейского голавля (Squalius cephalus) был выделен на клетках эпителиомы papulosum cyprini (EPC).Просвечивающая электронная микроскопия показала большое количество гексагональных вирусных частиц без оболочки в цитоплазме инфицированных клеток EPC, соответствующих иридовирусу. Данные последовательности Illumina MiSeq позволили собрать и аннотировать полный геном (128 216 п.н., кодирующих 108 открытых рамок считывания) подозреваемого иридовируса. Филогенетический анализ максимального правдоподобия, основанный на 25 основных генах иридовирусов, подтвердил, что европейский иридовирус голавля (ECIV) является родственным видом недавно обнаруженному вирусу чешуйчатой ​​болезни (SDDV), которые вместе образуют базальную кладу мегалоцивирусов.Генетический анализ главного капсидного белка ECIV и генов АТФазы выявил наибольшую нуклеотидную идентичность с представителями рода Megalocytivirus, включая SDDV. Эти данные подтверждают, что ECIV является новым членом рода Megalocytivirus. Необходимы экспериментальные исследования проблем, чтобы выполнить постулаты Ривера {\ textquoteright} и определить, вызывает ли ECIV патогномоничные микроскопические поражения (т.е. мегалоциты с базофильными цитоплазматическими включениями), наблюдаемые при мегалоцивирусных инфекциях.»,

    keywords =» Европейский голавль, Иридовирус, Мегалоцивирус «,

    author =» Халали, {Майя А.} и Куттичантран Субраманиам и Кода, {Саманта А.} и Попов, {Всеволод Л.} и Дэвид Стоун и Кейт Уэй и Вальцек, {Thomas B.} «,

    note =» Авторские права издателя: {\ textcopyright} 2019 авторов. Лицензиат MDPI, Базель, Швейцария. Авторские права: Copyright 2019 Elsevier B.V., Все права защищены. «,

    год =» 2019 «,

    месяц = ​​май,

    doi =» 10.3390 / v11050440 «,

    language =» English (US) «,

    volume =» 11 «,

    journal =» Viruses «,

    issn =» 1999-4915 «,

    publisher =» Multidisciplinary Digital Publishing Institute (MDPI) «,

    number =» 5 «,

    }

    Определение генотипа мегалоцивируса из индонезийских морских рыб

    Murwantoko, Sari DWK, Handayani CR, Whittington RJ. 2018. Определение генотипа мегалоцивируса индонезийских морских рыб.Biodiversitas 19: 1730-1736. Мегалоцивирус — новейший род в семействе Iridoviridae, который можно разделить на группы, представленные иридовирусом красного морского леща (RSIV), вирусом инфекционного некроза селезенки и почек (ISKNV) и иридовирусом красноватого тельца камбалы (TRBIV), вирусом тройной колюшки. (TSIV). Этот вирус вызвал серьезное системное заболевание у разводимых морских рыб для потребления и декоративных пресноводных рыб со значительной смертностью. Целью этого исследования было определение генотипа мегалоцивируса, инфицировавшего морских рыб из Лампунга, Каримун-Джавы, Ситубондо и Батама, на основе основного капсидного белка (MCP), АТФазы, ДНК-полимеразы, CY15 и IRB6.Ткани печени, селезенки и почек горбатого морского окуня ( Cromileptes altivelis ), тигрового морского окуня ( Epinephelus fuscoguttatus ), барамунди ( Lates calcarifer ) фиксировали в 10% фосфатно-буферном фиксированном растворе в 70% этаноле для гистологического раствора. для молекулярного анализа. Молекулярный анализ выполняли путем амплификации генов МСР, АТФазы, ДНК-полимеразы, CY15 и IRB6 с последующим секвенированием. Генотип определяли выравниванием последовательностей с различными генотипами мегалоцивируса из Genbank.Гистологическое исследование показало, что в тканях печени, селезенки и почек были обнаружены гипертрофии, клетки, несущие тельца включения.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *